G170339


Basic Information

Item Value
gene id G170339
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 3606701 ~ 3606923 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU193519
GTGAACTTTTCGAACTATAAAGGTAAGAATGACGGTCTCTTCTTCACTCCAATTGTCGCGTTTTCCATCGCCGTTTGACATTTTTCCTATCATACACAGAAACGACTGTTTATACATCGCGCGGTGTTTCCGTGCCTGACCAAAGCGCGTGAATATAAGGCACGCGATTGATTGTCGGTTGCTAAGCATCTAGTTGCAACATTCTAACACCGCATCGTTTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU193519 True 223 lncRNA 0.44 1 3606701 3606923

Neighbor

gene id symbol gene type direction distance location
CI01000034_03556390_03566045 NA coding upstream 40176 3554625 ~ 3566525 (+)
CI01000034_03533995_03552021 SPOP coding upstream 54596 3533995 ~ 3552105 (+)
CI01000034_03432846_03437608 NDUFA4, NDUFA4L coding upstream 168868 3432846 ~ 3438839 (+)
CI01000034_03422028_03431218 SLC35B1, S35B1 coding upstream 175105 3421289 ~ 3431596 (+)
CI01000034_03407574_03419313 FAM117A, FAM117AA coding upstream 187310 3405952 ~ 3419391 (+)
CI01000034_03656686_03659087 NA coding downstream 49763 3656686 ~ 3659172 (+)
CI01000034_03670122_03684523 NA coding downstream 63020 3669943 ~ 3685216 (+)
CI01000034_03855726_03858565 NA coding downstream 248628 3855551 ~ 3859311 (+)
CI01000034_03869116_03883535 SLC4A1A coding downstream 262193 3869116 ~ 3883690 (+)
CI01000034_03887718_03890074 NA coding downstream 280242 3887165 ~ 3890409 (+)
G170336 NA non-coding upstream 3473 3603014 ~ 3603228 (+)
G170332 NA non-coding upstream 6485 3600004 ~ 3600216 (+)
G170330 NA non-coding upstream 7762 3598702 ~ 3598939 (+)
G170328 NA non-coding upstream 8824 3597678 ~ 3597877 (+)
G170305 NA non-coding upstream 30063 3576427 ~ 3576638 (+)
G170342 NA non-coding downstream 2421 3609344 ~ 3689703 (+)
G170420 NA non-coding downstream 229174 3836097 ~ 3836354 (+)
G170432 NA non-coding downstream 240645 3847568 ~ 3847818 (+)
G170435 NA non-coding downstream 243644 3850567 ~ 3850890 (+)
G170437 NA non-coding downstream 249009 3855932 ~ 3856175 (+)
G169806 NA other upstream 1269011 2317973 ~ 2337690 (+)
CI01000034_01729413_01730790 EVE1 other upstream 1875524 1729413 ~ 1731179 (+)
G169340 NA other upstream 2295823 1250219 ~ 1310878 (+)
G169394 NA other upstream 2413141 1150297 ~ 1193560 (+)
CI01000034_04125435_04125780 RPRML other downstream 518177 4125100 ~ 4126825 (+)
CI01000034_04192675_04200041 NA other downstream 587715 4192311 ~ 4200636 (+)

Expression


Co-expression Network