G172480


Basic Information

Item Value
gene id G172480
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 4356313 ~ 4356554 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU195952
AGCTTCAAAGCTTCATGAAGCAGTGTTTTGAAATTGCCCATCACTAGATATTGTTGAATAAAGTCATTATTTTGTTTTTGTTTTTTGGCGCACAAAAAGTATTCTCGTCGCTTCATAACATTAAGATTGAACCACTGTAGTCACATGAACTATTTTAAAAATATGTCTTTAGTGCCTTTCTGGGTATTTGAAAGTGTTAATTATCTTGCTGTCAATGGAGGCCTCACTGACCCTGACAGCAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU195952 True 242 lncRNA 0.35 1 4356313 4356554

Neighbor

gene id symbol gene type direction distance location
CI01000034_04318823_04319740 FOXD3, FOXD1 coding downstream 36186 4318544 ~ 4320127 (-)
CI01000034_04239062_04242494 NA coding downstream 113673 4238771 ~ 4242640 (-)
CI01000034_04216451_04218876 NA coding downstream 134432 4216212 ~ 4221881 (-)
CI01000034_04174469_04189564 SEZ6L2 coding downstream 166749 4174416 ~ 4189564 (-)
CI01000034_04165535_04172272 KCTD13 coding downstream 184041 4165373 ~ 4172272 (-)
CI01000034_04370706_04374491 SPC24 coding upstream 14072 4370626 ~ 4375413 (-)
CI01000034_04376314_04386958 NA coding upstream 19760 4376314 ~ 4386958 (-)
CI01000034_04392399_04400096 LDLR, LDLRA coding upstream 35646 4392200 ~ 4400096 (-)
CI01000034_04431146_04446849 SMARCA4A, SMARCA4 coding upstream 74592 4431146 ~ 4447168 (-)
CI01000034_04451917_04454531 NA coding upstream 94905 4451459 ~ 4454531 (-)
G172475 NA non-coding downstream 21540 4334149 ~ 4334773 (-)
G172422 NA non-coding downstream 64567 4291531 ~ 4291746 (-)
G172421 NA non-coding downstream 65459 4290653 ~ 4290854 (-)
G172420 NA non-coding downstream 66218 4289847 ~ 4290095 (-)
G172419 NA non-coding downstream 78158 4277853 ~ 4278155 (-)
G172456 NA non-coding upstream 49081 4405635 ~ 4409237 (-)
G172488 NA non-coding upstream 112380 4468934 ~ 4469211 (-)
G172504 NA non-coding upstream 142450 4499004 ~ 4499747 (-)
G172507 NA non-coding upstream 159317 4515871 ~ 4516396 (-)
G172508 NA non-coding upstream 159939 4516493 ~ 4516717 (-)
G172151 NA other downstream 958500 3391144 ~ 3451802 (-)
G172016 NA other downstream 1119698 3234963 ~ 3236615 (-)
CI01000034_02510595_02511512 NA other downstream 1844792 2510061 ~ 2511521 (-)
G172593 NA other upstream 636406 4992960 ~ 4994943 (-)
G172800 NA other upstream 1432478 5789032 ~ 5789738 (-)
CI01000034_05795972_05811363 NA other upstream 1441016 5795835 ~ 5811781 (-)

Expression


Co-expression Network