G175877


Basic Information

Item Value
gene id G175877
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000037
NCBI id null
chromosome length 4612320
location 2645839 ~ 2646168 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU199772
TGACCCTGTCGCCGGTTCACCACTGTTCCTTCCTTGGACCACTTTGGATGGATACTGACCACTGCAGACCGGGAACACCCCACAAGAGTTGCAGTTTTGGAGATGCTCTGACCCAGTCATCTAGCCATCACAATCTGGCTCAAATCCTTACGCTTGCCCATTTTTCCTGCTTCTAACACATCAACTTTGAGGACAAAATGTTCACTTGCTGCCTAATATATCCCACCCACTAACAGGTGCCGTGATGAAGAGATAAGCACTGTTATTCACTTCACCTGTCAGTGGTCATAATGTTATGCCTGATCGATGTATAGTGCTACTGCCAACAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU199772 True 330 lncRNA 0.47 1 2645839 2646168

Neighbor

gene id symbol gene type direction distance location
CI01000037_02527352_02576225 TMTOPS2B coding upstream 69135 2526102 ~ 2576704 (+)
CI01000037_02414352_02418569 C6H2ORF40, ECRG4A coding upstream 227087 2414352 ~ 2418752 (+)
CI01000037_02405252_02406221 NA coding upstream 239402 2404783 ~ 2406437 (+)
CI01000037_02378066_02392175 NCK2A, NCK2 coding upstream 252968 2378066 ~ 2392871 (+)
CI01000037_02334480_02338932 NA coding upstream 306850 2331464 ~ 2338989 (+)
CI01000037_02700254_02707760 GPR89B, GPR89, GPR89A, GPR89B.L coding downstream 53427 2699595 ~ 2708474 (+)
CI01000037_02755842_02769590 NA coding downstream 109674 2755842 ~ 2771166 (+)
CI01000037_02907711_02908412 NA coding downstream 260895 2907063 ~ 2908634 (+)
CI01000037_02909777_02910445 NA coding downstream 263432 2909600 ~ 2910489 (+)
CI01000037_02965392_02966406 FAM155A coding downstream 319224 2965392 ~ 2966433 (+)
G175875 NA non-coding upstream 9530 2636095 ~ 2636309 (+)
G175871 NA non-coding upstream 19240 2625404 ~ 2626599 (+)
G175858 NA non-coding upstream 35844 2606378 ~ 2609995 (+)
G175777 NA non-coding upstream 232485 2412901 ~ 2413354 (+)
G175769 NA non-coding upstream 333128 2312207 ~ 2312711 (+)
G175850 NA non-coding downstream 23338 2669506 ~ 2715511 (+)
G175887 NA non-coding downstream 44183 2690351 ~ 2691089 (+)
G175849 NA non-coding downstream 69504 2715672 ~ 2720970 (+)
G176273 NA non-coding downstream 140693 2786861 ~ 2787562 (+)
G176292 NA non-coding downstream 151233 2797401 ~ 2798084 (+)
CI01000037_01965864_01966433 COA5, CB064 other upstream 675448 1965603 ~ 1966435 (+)
G174949 NA other upstream 1031565 1613876 ~ 1614274 (+)
CI01000037_00987906_00988350 NA other upstream 1656080 987859 ~ 989246 (+)
CI01000037_00228809_00230442 NA other upstream 2415443 228809 ~ 230730 (+)
G176346 NA other downstream 193592 2839760 ~ 2840053 (+)
G176377 NA other downstream 330694 2976862 ~ 3087968 (+)
CI01000037_04213179_04218057 NA other downstream 1567115 4212907 ~ 4218305 (+)

Expression


Co-expression Network