G180340


Basic Information

Item Value
gene id G180340
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 2380302 ~ 2380666 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU204772
ACGGCGAGGATTGGCGAGCTGGCGTTTCAAGAAAGCTTGGTTGTTTGACCAGGAGAGCCTATGTTGCCTCCAACGGGAGCAGTTCATGGCGCCGGGCGGACGGGCCCTACTGGCTGACAATTGAGGAGTAGCCGAAATTTGGAACGACCGATCGGGAGGGCTCTTGCAACATCCAGTGTTAGACCAAGGTTTACAGCATCGGGCGGGTAAAGCCCTACAGGCTGATAAATGAGGAGCAGCATGGGTCCTATTGGCCGACGGTGGGGTGAAAGATATTTGGAACGCCTGGCCAGGAGAGCTCTCGTGGCGTCTAACAGGAGACCAAGGCTCACAGTATGGGACGGGTAAGCCTTGGCGGACGGGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU204772 True 365 lncRNA 0.57 1 2380302 2380666

Neighbor

gene id symbol gene type direction distance location
CI01000039_02237032_02271442 VCANA coding downstream 108860 2236942 ~ 2271442 (-)
CI01000039_02144352_02144513 NA coding downstream 234742 2144219 ~ 2145560 (-)
CI01000039_01942473_01943188 NA coding downstream 436892 1942433 ~ 1943410 (-)
CI01000039_01721603_01723199 COX7C.L, COX7C, COX7C.S coding downstream 656759 1717656 ~ 1723543 (-)
CI01000039_01622940_01669780 RASA1, RASA1A coding downstream 710249 1622940 ~ 1670053 (-)
CI01000039_02425743_02427761 F2R coding upstream 44740 2425406 ~ 2427761 (-)
CI01000039_02428934_02448342 IQGAP2 coding upstream 48178 2428844 ~ 2448372 (-)
CI01000039_02451198_02486009 IQGAP2 coding upstream 70526 2451192 ~ 2486009 (-)
CI01000039_02497017_02533586 SV2C coding upstream 114801 2495467 ~ 2533613 (-)
CI01000039_02555748_02566361 ANKDD1B coding upstream 175057 2555723 ~ 2566361 (-)
G180347 NA non-coding downstream 18161 2361862 ~ 2362141 (-)
G180326 NA non-coding downstream 41359 2336417 ~ 2338943 (-)
G179445 NA non-coding downstream 100343 2279701 ~ 2279959 (-)
G179301 NA non-coding downstream 241189 2138737 ~ 2139113 (-)
G180351 NA non-coding upstream 6664 2387330 ~ 2400257 (-)
G180339 NA non-coding upstream 200978 2581644 ~ 2582037 (-)
G180328 NA non-coding upstream 205881 2586547 ~ 2588266 (-)
G180396 NA non-coding upstream 207664 2588330 ~ 2588671 (-)
G180397 NA non-coding upstream 208124 2588790 ~ 2589023 (-)
G180346 NA other downstream 22695 2357204 ~ 2357607 (-)
CI01000039_04240525_04242132 RPS27A, UBB, UBC other upstream 1859701 4240357 ~ 4242404 (-)
G180953 NA other upstream 2004200 4384866 ~ 4389529 (-)
CI01000039_04478095_04490812 NA other upstream 2109792 4478095 ~ 4491059 (-)
G182384 NA other upstream 3075825 5456491 ~ 5469288 (-)
G182470 NA other upstream 3255392 5636058 ~ 5636764 (-)

Expression


Co-expression Network