G179893


Basic Information

Item Value
gene id G179893
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 3323338 ~ 3323607 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU204248
GCTCTCACCCTCATTGATAAAGCACCACTGCTTTTGGAAAGTTAAAACTCTCCAGACAACATCAGATCTTTGGAATGTCTGTTTGTATAAACCGGTATAACTTTATTTCTTTTGTGGAAAACAAAATAAAACACACACACACACACACACACACACACACACACACGTTTGTTTTTGTGAATTGTGGGGACATTCCGTAGGCGTAATGGTTTTTATACTGTACAAACCGTATTTTCTATCACCCTACACTACACCTACCCCTAAACCTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU204248 True 270 lncRNA 0.39 1 3323338 3323607

Neighbor

gene id symbol gene type direction distance location
CI01000039_03181221_03188468 FBP2 coding upstream 134103 3180393 ~ 3189235 (+)
CI01000039_03170952_03179241 FBP1.S, F16P1, FBP1B, FBP1, FBP2, FBP1A coding upstream 144065 3169850 ~ 3179273 (+)
CI01000039_02934780_02935076 NA coding upstream 388108 2934635 ~ 2935230 (+)
CI01000039_02740498_02764324 NPFFR2A, NPFFR2 coding upstream 558510 2740242 ~ 2764828 (+)
CI01000039_02724018_02725548 NA coding upstream 597674 2724018 ~ 2725664 (+)
CI01000039_03352914_03354134 GAS1A coding downstream 27923 3351530 ~ 3354476 (+)
CI01000039_03359162_03369982 NA coding downstream 35288 3358895 ~ 3370403 (+)
CI01000039_03454189_03458136 NA coding downstream 130433 3454040 ~ 3458140 (+)
CI01000039_03596770_03597721 NA coding downstream 272390 3595997 ~ 3597726 (+)
CI01000039_03651436_03658228 NA coding downstream 327829 3651436 ~ 3658264 (+)
G179883 NA non-coding upstream 41901 3280776 ~ 3281437 (+)
G179802 NA non-coding upstream 55110 3267812 ~ 3268228 (+)
G179876 NA non-coding upstream 56217 3266529 ~ 3267121 (+)
G179875 NA non-coding upstream 59235 3262870 ~ 3264103 (+)
G179874 NA non-coding upstream 61024 3261973 ~ 3262314 (+)
G179909 NA non-coding downstream 48219 3371826 ~ 3372040 (+)
G179933 NA non-coding downstream 78427 3402034 ~ 3402456 (+)
G179900 NA non-coding downstream 85684 3409291 ~ 3410398 (+)
G179901 NA non-coding downstream 87400 3411007 ~ 3411431 (+)
G179899 NA non-coding downstream 88185 3411792 ~ 3414176 (+)
G179798 NA other upstream 191154 3129572 ~ 3132184 (+)
G179528 NA other upstream 824719 2497674 ~ 2498619 (+)
G178423 NA other upstream 2337586 966676 ~ 982406 (+)
G179903 NA other downstream 100430 3424037 ~ 3425555 (+)
CI01000039_04048342_04049635 NA other downstream 724686 4048079 ~ 4049972 (+)
G180149 NA other downstream 751269 4079419 ~ 4079563 (+)
G180156 NA other downstream 767391 4090998 ~ 4091608 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L other downstream 899972 4223868 ~ 4224657 (+)

Expression


Co-expression Network