G180157


Basic Information

Item Value
gene id G180157
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 4092488 ~ 4092835 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU204562
GTCTAGTTTAATCATCCTCTTTTAAGTGTGAATAGGCTTCACCATTCGACATATCCCAATTTTAATGTAACCCATTAAACTATATAATTTATAACTTCTTTTACCATCAGGCACCTTCAGTATTATATTTTGTAATATTTTATAAACTGTGTATTTGTCAAATTCCAAAATACTAAAAACTCAACCACATCAATCATTAATAATTTTTTCATTTTAAATCATTAATCATTGTTTTTATATGTATCCTCAAACTTTACTTCTTAAGCAATTTAAGTACAACCTCTACAGCTTTTAAACATTTTATTCTTTATAAAAGACTTCAAAATCAAATTATTAAATACACATTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU204562 True 348 lncRNA 0.24 1 4092488 4092835

Neighbor

gene id symbol gene type direction distance location
CI01000039_04078795_04079273 NA coding upstream 13215 4078745 ~ 4079273 (+)
CI01000039_04070151_04075216 NA coding upstream 17127 4070098 ~ 4075361 (+)
CI01000039_04065787_04066284 NA coding upstream 25857 4065669 ~ 4066653 (+)
CI01000039_04062068_04062375 NA coding upstream 29550 4062003 ~ 4062961 (+)
CI01000039_04058417_04059141 NA coding upstream 32985 4058343 ~ 4059526 (+)
CI01000039_04108687_04120437 FLOT2A, FLT2, FLOT2B, FLOT2 coding downstream 15852 4108687 ~ 4120437 (+)
CI01000039_04198172_04200073 FAM222BA coding downstream 104411 4197246 ~ 4200160 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L coding downstream 131053 4223868 ~ 4224657 (+)
CI01000039_04244908_04247540 CENPV coding downstream 151669 4244504 ~ 4247540 (+)
CI01000039_04295776_04307914 NCOR1 coding downstream 202941 4295776 ~ 4307914 (+)
G180156 NA non-coding upstream 880 4090998 ~ 4091608 (+)
G180155 NA non-coding upstream 3262 4088971 ~ 4089226 (+)
G180146 NA non-coding upstream 20916 4070588 ~ 4071572 (+)
G180111 NA non-coding upstream 116788 3975058 ~ 3975700 (+)
G180160 NA non-coding downstream 32713 4125548 ~ 4125931 (+)
G180185 NA non-coding downstream 36419 4129254 ~ 4129494 (+)
G180188 NA non-coding downstream 40926 4133761 ~ 4134014 (+)
G180165 NA non-coding downstream 41548 4134383 ~ 4135372 (+)
G180173 NA non-coding downstream 122123 4214958 ~ 4215578 (+)
G180149 NA other upstream 12925 4079419 ~ 4079563 (+)
CI01000039_04048342_04049635 NA other upstream 42516 4048079 ~ 4049972 (+)
G179903 NA other upstream 666933 3424037 ~ 3425555 (+)
G179798 NA other upstream 960304 3129572 ~ 3132184 (+)
CI01000039_04829464_04847182 ZFR other downstream 751347 4829413 ~ 4848563 (+)
CI01000039_07324920_07329407 NA other downstream 3227849 7324596 ~ 7329472 (+)
CI01000039_07898330_07904918 DPF2 other downstream 3803041 7896773 ~ 7905162 (+)

Expression


Co-expression Network