G180160


Basic Information

Item Value
gene id G180160
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 4125548 ~ 4125931 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU204565
ATGCGACATTCACTTCATCACGCAAAGCCAGACTCACCTGTTCAGGTGTCTGTTACTGAGACTGAGAATGGTGTGGGTCTGCTGGGGTGAAGGTGCTCCAACCGTGCTGAGGTTTATGAAGGCTGATATGAAAGGGTTTGGGGTGACAGATGAAGCCACTTCTGAAAAATGTAGGGTACTGCTGCTGTCAACAGAGCTGGACACGGTCACATCCACATCCTCGTCTTTCTGTGACTGTCCCACTGCTATTGGGACAAAAAATAAGCAAAAATACTGAAACTAAATGTACACAGTTTATTTTTTAAACAGTCTGTCCAAAGAAAAACAGCTAATCAAGTAGTAAGTAAAATGTAGGGCACATGAATACGATCCTCACGATTAAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU204565 True 384 lncRNA 0.44 1 4125548 4125931

Neighbor

gene id symbol gene type direction distance location
CI01000039_04108687_04120437 FLOT2A, FLT2, FLOT2B, FLOT2 coding upstream 5111 4108687 ~ 4120437 (+)
CI01000039_04078795_04079273 NA coding upstream 46275 4078745 ~ 4079273 (+)
CI01000039_04070151_04075216 NA coding upstream 50187 4070098 ~ 4075361 (+)
CI01000039_04065787_04066284 NA coding upstream 58917 4065669 ~ 4066653 (+)
CI01000039_04062068_04062375 NA coding upstream 62610 4062003 ~ 4062961 (+)
CI01000039_04198172_04200073 FAM222BA coding downstream 71315 4197246 ~ 4200160 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L coding downstream 97957 4223868 ~ 4224657 (+)
CI01000039_04244908_04247540 CENPV coding downstream 118573 4244504 ~ 4247540 (+)
CI01000039_04295776_04307914 NCOR1 coding downstream 169845 4295776 ~ 4307914 (+)
CI01000039_04364813_04366029 NA coding downstream 238238 4364169 ~ 4366231 (+)
G180157 NA non-coding upstream 32713 4092488 ~ 4092835 (+)
G180156 NA non-coding upstream 33940 4090998 ~ 4091608 (+)
G180155 NA non-coding upstream 36322 4088971 ~ 4089226 (+)
G180146 NA non-coding upstream 53976 4070588 ~ 4071572 (+)
G180185 NA non-coding downstream 3323 4129254 ~ 4129494 (+)
G180188 NA non-coding downstream 7830 4133761 ~ 4134014 (+)
G180165 NA non-coding downstream 8452 4134383 ~ 4135372 (+)
G180173 NA non-coding downstream 89027 4214958 ~ 4215578 (+)
G180183 NA non-coding downstream 90039 4215970 ~ 4216186 (+)
G180149 NA other upstream 45985 4079419 ~ 4079563 (+)
CI01000039_04048342_04049635 NA other upstream 75576 4048079 ~ 4049972 (+)
G179903 NA other upstream 699993 3424037 ~ 3425555 (+)
G179798 NA other upstream 993364 3129572 ~ 3132184 (+)
CI01000039_04829464_04847182 ZFR other downstream 718251 4829413 ~ 4848563 (+)
CI01000039_07324920_07329407 NA other downstream 3194753 7324596 ~ 7329472 (+)
CI01000039_07898330_07904918 DPF2 other downstream 3769945 7896773 ~ 7905162 (+)

Expression


Co-expression Network