G182721



Basic Information


Item Value
gene id G182721
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 6393604 ~ 6393840 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU207504
GGCAACATGTCTGTCGTGGCATTTGCTGAGATCAAGTGTTAAAATGAGTTCCTCTATGACATTGTCACTAGTCCTCCTCTTCTAAGTACTTGGAAAATCTTCAGGGACTTTATCCTTGCTGTTAGTACTGCAGTAGAAAAAACATCTGTCTGCTGTTATCATGCAGGGACCACAGCGTCAGCTAGTGGAAGTGGAAATGATCAAAGTTGCTTGTCATTTTAGTTTTGTATTCAAAAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU207504 True 237 lncRNA 0.41 1 6393604 6393840

Neighbor


gene id symbol gene type direction distance location
CI01000039_06361313_06381595 MAP1B coding downstream 11947 6360806 ~ 6381657 (-)
CI01000039_06347202_06354469 NA coding downstream 39135 6347024 ~ 6354469 (-)
CI01000039_06322466_06325312 NA coding downstream 68292 6321123 ~ 6325312 (-)
CI01000039_06254464_06256853 MOGAT3B, MOGAT3 coding downstream 136751 6254418 ~ 6256853 (-)
CI01000039_06240103_06241511 NA coding downstream 151813 6239599 ~ 6241791 (-)
CI01000039_06444483_06468488 TTC33 coding upstream 48524 6442364 ~ 6468488 (-)
CI01000039_06507869_06512333 NA coding upstream 113918 6507758 ~ 6512333 (-)
CI01000039_06561801_06580642 NA coding upstream 166517 6560357 ~ 6580763 (-)
CI01000039_06647926_06651530 NA coding upstream 252870 6646544 ~ 6653449 (-)
CI01000039_06702521_06707733 NA coding upstream 307766 6701606 ~ 6707733 (-)
G182712 NA non-coding downstream 7940 6385349 ~ 6385664 (-)
G182710 NA non-coding downstream 9742 6383234 ~ 6383862 (-)
G182695 NA non-coding downstream 66762 6326631 ~ 6326842 (-)
G182669 NA non-coding downstream 157945 6235126 ~ 6235659 (-)
CI01000039_06199595_06200036 NA non-coding downstream 193430 6197567 ~ 6200319 (-)
G182729 NA non-coding upstream 5639 6399479 ~ 6399715 (-)
G182745 NA non-coding upstream 22532 6416372 ~ 6417070 (-)
G182746 NA non-coding upstream 23705 6417545 ~ 6417793 (-)
G182747 NA non-coding upstream 26280 6420120 ~ 6420442 (-)
G182748 NA non-coding upstream 26974 6420814 ~ 6421042 (-)
G182470 NA other downstream 756840 5636058 ~ 5636764 (-)
G182384 NA other downstream 924316 5456491 ~ 5469288 (-)
CI01000039_04478095_04490812 NA other downstream 1902545 4478095 ~ 4491059 (-)
G180953 NA other downstream 2004075 4384866 ~ 4389529 (-)
CI01000039_04240525_04242132 RPS27A, UBB, UBC other downstream 2151200 4240357 ~ 4242404 (-)
G182771 NA other upstream 114115 6507955 ~ 6508433 (-)
G182827 NA other upstream 240707 6634547 ~ 6635200 (-)
CI01000039_07134422_07137732 NA other upstream 740267 7134422 ~ 7137767 (-)
G183261 NA other upstream 1578276 7972116 ~ 7975045 (-)

Expression



Co-expression Network