G181754


Basic Information

Item Value
gene id G181754
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 6429140 ~ 6429414 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU206397
AGCTATGATCAGCTGTTTGGCTGAAATTTCGATGTTTTGTTACGGAAAGGCCGAAGTTGATCGGTTGGTTCTTGTCACATGACTTGCGGTGCGCTTGCGGCATTCTGAAAAGTTGAGATGTTTTCATCTCGATGAGCCTGGAAAATGCACCCCATGCGCGTCGCGACCGCGTCGCTTCCATTATGAGCGCGCCTGCCGCGCGGCTACATTTGAAATAACTGACTTGCGCGCGGAAAAGACGCGATATGTGAACGGCTCCTAAAAACGCTTTGGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU206397 True 275 lncRNA 0.51 1 6429140 6429414

Neighbor

gene id symbol gene type direction distance location
CI01000039_06313617_06317466 ATP1B2B coding upstream 110395 6313433 ~ 6318745 (+)
CI01000039_06288292_06297288 NYAP1 coding upstream 131694 6288162 ~ 6297446 (+)
CI01000039_06282705_06284628 NA coding upstream 144209 6281904 ~ 6284931 (+)
CI01000039_06251772_06253349 ZNHIT1 coding upstream 175682 6251582 ~ 6253458 (+)
CI01000039_06153269_06173038 CNOT6L coding upstream 255490 6153269 ~ 6173650 (+)
CI01000039_06436994_06439467 PTGER4B coding downstream 7580 6436994 ~ 6439604 (+)
CI01000039_06472455_06491979 ERLIN2.S, ERLN2, ERLIN2 coding downstream 43041 6472455 ~ 6492462 (+)
CI01000039_06517676_06525898 NA coding downstream 88112 6517526 ~ 6525947 (+)
CI01000039_06584621_06616401 AR coding downstream 155207 6584621 ~ 6616401 (+)
CI01000039_06677303_06686187 AR coding downstream 247889 6677303 ~ 6686864 (+)
G181753 NA non-coding upstream 34 6428614 ~ 6429106 (+)
G181751 NA non-coding upstream 4722 6423559 ~ 6424418 (+)
G181737 NA non-coding upstream 28237 6400674 ~ 6400903 (+)
G181734 NA non-coding upstream 31152 6397761 ~ 6397988 (+)
G181728 NA non-coding upstream 35059 6393877 ~ 6394081 (+)
G181755 NA non-coding downstream 5867 6435281 ~ 6435489 (+)
G181762 NA non-coding downstream 38928 6468342 ~ 6468570 (+)
G181768 NA non-coding downstream 75790 6505204 ~ 6505547 (+)
G181770 NA non-coding downstream 78478 6507892 ~ 6508503 (+)
G181781 NA non-coding downstream 101946 6531360 ~ 6531560 (+)
CI01000039_04829464_04847182 ZFR other upstream 1580577 4829413 ~ 4848563 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L other upstream 2204483 4223868 ~ 4224657 (+)
G180156 NA other upstream 2337532 4090998 ~ 4091608 (+)
G180149 NA other upstream 2349577 4079419 ~ 4079563 (+)
CI01000039_04048342_04049635 NA other upstream 2379168 4048079 ~ 4049972 (+)
CI01000039_07324920_07329407 NA other downstream 891270 7324596 ~ 7329472 (+)
CI01000039_07898330_07904918 DPF2 other downstream 1466462 7896773 ~ 7905162 (+)

Expression


Co-expression Network