G182000


Basic Information

Item Value
gene id G182000
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 7349972 ~ 7350205 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU206698
CTTTAAGTTACTTGTCTTACGGTAATTCTTTACCTAAGACACTTTTCTTTTGCTGCTTCACAACCATTGGCATTTTCTTGCACTTTCATGCTGTGTATTTATGACTTTCATTTTTATGGTGCCACTGCTGCCAGTCCACTTGTAGTATAAAGCCTGGGACACACTAAGCCGACTTCAAAGAACTAGTGGCAACGAAAACCAGTGGTGCTGTCGGCTCACGTCGGCTGCGTCTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU206698 True 234 lncRNA 0.44 1 7349972 7350205

Neighbor

gene id symbol gene type direction distance location
CI01000039_07324920_07329407 NA coding upstream 20500 7324596 ~ 7329472 (+)
CI01000039_07299805_07316808 MARK4A coding upstream 31997 7299805 ~ 7317975 (+)
CI01000039_07268272_07278840 EXOC3L2A coding upstream 71073 7268169 ~ 7278899 (+)
CI01000039_07259359_07263181 NA coding upstream 86344 7259230 ~ 7263628 (+)
CI01000039_07236216_07240207 DLB coding upstream 108758 7235981 ~ 7241214 (+)
CI01000039_07362633_07380267 HNRPL coding downstream 12027 7362232 ~ 7380499 (+)
CI01000039_07394034_07396192 CRX coding downstream 42588 7392793 ~ 7396259 (+)
CI01000039_07412923_07415375 NA coding downstream 62516 7412721 ~ 7415525 (+)
CI01000039_07425682_07427826 GJD1A coding downstream 75477 7425682 ~ 7427957 (+)
CI01000039_07442137_07446489 NA coding downstream 91387 7441592 ~ 7447160 (+)
G181999 NA non-coding upstream 2770 7346805 ~ 7347202 (+)
G181998 NA non-coding upstream 3205 7346505 ~ 7346767 (+)
G181997 NA non-coding upstream 4474 7345261 ~ 7345498 (+)
G181995 NA non-coding upstream 8656 7340986 ~ 7341316 (+)
G181992 NA non-coding upstream 10657 7339090 ~ 7339315 (+)
G182004 NA non-coding downstream 33361 7383566 ~ 7384309 (+)
G182014 NA non-coding downstream 49961 7400166 ~ 7400397 (+)
G181962 NA non-coding downstream 50376 7400581 ~ 7402300 (+)
G182067 NA non-coding downstream 131433 7481638 ~ 7482002 (+)
G182063 NA non-coding downstream 134890 7485095 ~ 7485424 (+)
CI01000039_04829464_04847182 ZFR other upstream 2501409 4829413 ~ 4848563 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L other upstream 3125315 4223868 ~ 4224657 (+)
G180156 NA other upstream 3258364 4090998 ~ 4091608 (+)
G180149 NA other upstream 3270409 4079419 ~ 4079563 (+)
CI01000039_07898330_07904918 DPF2 other downstream 545671 7896773 ~ 7905162 (+)

Expression


Co-expression Network