G183140


Basic Information

Item Value
gene id G183140
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 7481633 ~ 7481993 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU207969
GAAACTAAGGGCTTAAAAACCAGGGAGAGTTAATTACCAGAACAGAAACGGTTGCGGGATTAATCAGAACCTAATGACCAAGAAACACAGGCAAAACGGGAACAGGGAAAACGAAACCAAAACACAGTGAAACTAAACAGACACATAACCCTGACATTACTATGACCACCACCCTCCTCCTAGATGAGGGGCTGGTGGCGGGAGAAACTGCAGAACCTGATTTTACAAAGTGCAGCATGTTACTGGATGAACATCTTTGTTGATCCTGGAACAACATTCCAGTTAACCAATCAGATTTGAGGGACACTTTTACAGTTTACGTCAAGTTTAGGCTTACAACCAGGTTTAGATGCTTTTACAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU207969 True 361 lncRNA 0.42 1 7481633 7481993

Neighbor

gene id symbol gene type direction distance location
CI01000039_07450597_07454594 NA coding downstream 27003 7449808 ~ 7454630 (-)
CI01000039_07401817_07402410 H3F3AP4, H3F3C, H3F3B, H3F3A, GM6421 coding downstream 78994 7400571 ~ 7402639 (-)
CI01000039_07385848_07389331 KPTN coding downstream 91143 7384829 ~ 7390490 (-)
CI01000039_07320926_07323244 CKM, CKM.S, CKMA, CKM2 coding downstream 156980 7320717 ~ 7324653 (-)
CI01000039_07165860_07166458 RHOG, RHOGC coding downstream 315175 7164783 ~ 7166458 (-)
CI01000039_07498583_07505779 NA coding upstream 16510 7498503 ~ 7506602 (-)
CI01000039_07523213_07573865 LRCH2 coding upstream 41204 7523197 ~ 7576151 (-)
CI01000039_07592640_07593317 NA coding upstream 110555 7592548 ~ 7595053 (-)
CI01000039_07619613_07632295 WDR44 coding upstream 136887 7618880 ~ 7632295 (-)
CI01000039_07658015_07658757 NA coding upstream 175547 7657540 ~ 7659052 (-)
G183135 NA non-coding downstream 16443 7463121 ~ 7465190 (-)
G183121 NA non-coding downstream 52992 7427024 ~ 7428641 (-)
G182998 NA non-coding downstream 119484 7360936 ~ 7362149 (-)
G182997 NA non-coding downstream 124813 7354970 ~ 7356820 (-)
G183106 NA non-coding downstream 132892 7348437 ~ 7348741 (-)
G183142 NA non-coding upstream 2584 7484577 ~ 7484808 (-)
G183143 NA non-coding upstream 3126 7485119 ~ 7485485 (-)
G183150 NA non-coding upstream 13772 7495765 ~ 7496011 (-)
G183151 NA non-coding upstream 14067 7496060 ~ 7496326 (-)
G183154 NA non-coding upstream 113131 7595124 ~ 7595358 (-)
CI01000039_07134422_07137732 NA other downstream 343866 7134422 ~ 7137767 (-)
CI01000039_06647926_06651530 NA other downstream 833057 6646544 ~ 6653449 (-)
G182827 NA other downstream 846433 6634547 ~ 6635200 (-)
G182771 NA other downstream 973200 6507955 ~ 6508433 (-)
G182470 NA other downstream 1844869 5636058 ~ 5636764 (-)
G183261 NA other upstream 490123 7972116 ~ 7975045 (-)

Expression


Co-expression Network