G183233


Basic Information

Item Value
gene id G183233
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 7780063 ~ 7780273 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU208080
AGAGCATTTGCTCATCTGCAATACGTCTATAGGACGTTTCCTGTCAGATGTCAAATAGACGTTTAGAAGATGTCTTTAAGATGTTTATGATTTAGAATGTATGTAAAACTGACATCTTAAAGATGTCTATCAGATGTTTGTAAACAGCAGATGTTTTCCAGATGAAGTGATCTTTAACAGACATCTTGCAGATGTATGTGTGCTATCTGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU208080 True 211 lncRNA 0.36 1 7780063 7780273

Neighbor

gene id symbol gene type direction distance location
CI01000039_07658015_07658757 NA coding downstream 121011 7657540 ~ 7659052 (-)
CI01000039_07619613_07632295 WDR44 coding downstream 147768 7618880 ~ 7632295 (-)
CI01000039_07592640_07593317 NA coding downstream 185010 7592548 ~ 7595053 (-)
CI01000039_07523213_07573865 LRCH2 coding downstream 203912 7523197 ~ 7576151 (-)
CI01000039_07498583_07505779 NA coding downstream 273461 7498503 ~ 7506602 (-)
CI01000039_07781930_07783389 NA coding upstream 1617 7781890 ~ 7783694 (-)
CI01000039_07908291_07909766 NA coding upstream 127631 7907904 ~ 7910468 (-)
CI01000039_07952703_07961286 NA coding upstream 172013 7952286 ~ 7962019 (-)
CI01000039_07987279_07996351 ARHGAP35 coding upstream 206939 7987212 ~ 7996921 (-)
CI01000039_08003424_08011297 NA coding upstream 223137 8003410 ~ 8012533 (-)
G183232 NA non-coding downstream 1421 7778331 ~ 7778642 (-)
G183231 NA non-coding downstream 2671 7776728 ~ 7777392 (-)
G183214 NA non-coding downstream 4881 7770429 ~ 7775182 (-)
G183212 NA non-coding downstream 45153 7734543 ~ 7734910 (-)
G183154 NA non-coding downstream 184705 7595124 ~ 7595358 (-)
G183282 NA non-coding upstream 78012 7858285 ~ 7861483 (-)
G183311 NA non-coding upstream 112691 7892964 ~ 7893415 (-)
G183314 NA non-coding upstream 114716 7894989 ~ 7895210 (-)
G183316 NA non-coding upstream 115520 7895793 ~ 7898833 (-)
G183277 NA non-coding upstream 139440 7919713 ~ 7920638 (-)
CI01000039_07134422_07137732 NA other downstream 642296 7134422 ~ 7137767 (-)
CI01000039_06647926_06651530 NA other downstream 1131487 6646544 ~ 6653449 (-)
G182827 NA other downstream 1144863 6634547 ~ 6635200 (-)
G182771 NA other downstream 1271630 6507955 ~ 6508433 (-)
G182470 NA other downstream 2143299 5636058 ~ 5636764 (-)
G183261 NA other upstream 191843 7972116 ~ 7975045 (-)

Expression


Co-expression Network