G182239


Basic Information

Item Value
gene id G182239
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 8286973 ~ 8291456 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU206959
TTTGTAGTGAGAGTCTCCTCTTTTTCATTCAAAGAGATGAGGTTGGTGAGGGTTAACTTGACCTGAACCTTCACTTTTTCATCAGTGTTTCTTGCTGGTCGAATATTTTTATTGTAGTTCTTAAACTTATCTGCAATCAACTGCCTCTCCTCATTTCCACTGACTTGTAATACAGTGACCACGAGCGCAAATGCAAATACACACGTCCTGCCGAACCGGTCGGCCATGGCCATGATCAGCAAAACACGGTCCTAAAAGTTGGTAACAAAGAGACAGACACGTTACTTTCCAGCAGTCAGTAACCGAGCTTTCTCTTCTCTTCGGTGCTTACAGCTGTCACTGCACGAGGCTCGAGTTACAGCGCTGGAGCGCGCTCTTAAAGTCACATTCACTAATCGCCAATATCATAATAGCACTAATACGCAACAATGATTCAGATTATGTGAGTTACTTTTCAAGTATTACTGTGAGTGATATCAGATATTATGAATAGAGCCCAAAAAAATGCTGATAGGAGGACCATAAATTTCAAGTGCCAATCGCCAAGACTTCGGTTCTCTCACTTCTGCGCGAGCTCATGATGATGCTGACAGTCGTTCATTTCGAGTATCACAATGGCTTAATGATGATACGTATAACGGTTATTGATAGTGTTGCTCAGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU206959 True 663 lncRNA 0.43 3 8286973 8291456

Neighbor

gene id symbol gene type direction distance location
CI01000039_08200873_08207267 GNB2 coding upstream 78849 8199134 ~ 8208124 (+)
CI01000039_08166944_08171773 NA coding upstream 115200 8166853 ~ 8171773 (+)
CI01000039_08113233_08115430 NA coding upstream 170831 8113233 ~ 8116142 (+)
CI01000039_08083646_08085318 NA coding upstream 200789 8083646 ~ 8086184 (+)
CI01000039_08052093_08053571 APOA1A coding upstream 233263 8051815 ~ 8053710 (+)
CI01000039_08302787_08303257 NA coding downstream 11331 8302787 ~ 8303472 (+)
CI01000039_08323007_08331689 SVOP, SVOPA coding downstream 31551 8323007 ~ 8331754 (+)
G182203 NA non-coding upstream 197767 8088832 ~ 8089206 (+)
G182197 NA non-coding upstream 209931 8076837 ~ 8077042 (+)
G182195 NA non-coding upstream 211874 8074680 ~ 8075099 (+)
G182194 NA non-coding upstream 212432 8074337 ~ 8074541 (+)
G182185 NA non-coding upstream 304979 7981444 ~ 7981994 (+)
G182242 NA non-coding downstream 1115 8292571 ~ 8292915 (+)
G182248 NA non-coding downstream 24618 8316074 ~ 8316325 (+)
G182250 NA non-coding downstream 30376 8321832 ~ 8322058 (+)
CI01000039_07898330_07904918 DPF2 other upstream 388217 7896773 ~ 7905162 (+)
CI01000039_07324920_07329407 NA other upstream 962276 7324596 ~ 7329472 (+)
CI01000039_04829464_04847182 ZFR other upstream 3438410 4829413 ~ 4848563 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L other upstream 4062316 4223868 ~ 4224657 (+)
G180156 NA other upstream 4195365 4090998 ~ 4091608 (+)

Expression


Co-expression Network