G182242


Basic Information

Item Value
gene id G182242
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 8292571 ~ 8292915 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU206962
TTCCTGTCTCCTTTGTGTACTATTAATATGACCTGAAATTGAACCGTGTTCCATGTGGGTAACCGGAAACTCCACATCCGGAGAAACGTGACACAATGTCTTTGCCAAATGAGAATGTCAAAGATGCATGTGATAAGTGTCATGAGCAGTGACTTTTTGTCTTAATTTGTCTTACCAAAATGTATTCATCATGTTGGGACCACATGTCTCAAAACAGGTCTTAATCTCACTACTGAGGATGTAGCAAACATCCCAAATTGTTATACAGATGAAAAGCCTCCTGCAAAAATGTTGAAGATAAGGGTTGCTTGGCTTGCATCCCCGCACCTCCTCAACTCCACATTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU206962 True 345 lncRNA 0.41 1 8292571 8292915

Neighbor

gene id symbol gene type direction distance location
CI01000039_08200873_08207267 GNB2 coding upstream 84447 8199134 ~ 8208124 (+)
CI01000039_08166944_08171773 NA coding upstream 120798 8166853 ~ 8171773 (+)
CI01000039_08113233_08115430 NA coding upstream 176429 8113233 ~ 8116142 (+)
CI01000039_08083646_08085318 NA coding upstream 206387 8083646 ~ 8086184 (+)
CI01000039_08052093_08053571 APOA1A coding upstream 238861 8051815 ~ 8053710 (+)
CI01000039_08302787_08303257 NA coding downstream 9872 8302787 ~ 8303472 (+)
CI01000039_08323007_08331689 SVOP, SVOPA coding downstream 30092 8323007 ~ 8331754 (+)
G182239 NA non-coding upstream 1115 8286973 ~ 8291456 (+)
G182203 NA non-coding upstream 203365 8088832 ~ 8089206 (+)
G182197 NA non-coding upstream 215529 8076837 ~ 8077042 (+)
G182195 NA non-coding upstream 217472 8074680 ~ 8075099 (+)
G182194 NA non-coding upstream 218030 8074337 ~ 8074541 (+)
G182248 NA non-coding downstream 23159 8316074 ~ 8316325 (+)
G182250 NA non-coding downstream 28917 8321832 ~ 8322058 (+)
CI01000039_07898330_07904918 DPF2 other upstream 393815 7896773 ~ 7905162 (+)
CI01000039_07324920_07329407 NA other upstream 967874 7324596 ~ 7329472 (+)
CI01000039_04829464_04847182 ZFR other upstream 3444008 4829413 ~ 4848563 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L other upstream 4067914 4223868 ~ 4224657 (+)
G180156 NA other upstream 4200963 4090998 ~ 4091608 (+)

Expression


Co-expression Network