CI01000040_03761247_03762668 (BOD1, FA44B)


Basic Information

Item Value
gene id CI01000040_03761247_03762668
gene name BOD1, FA44B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 3761161 ~ 3762674 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000040_03761247_03762668.mRNA
TTATATATTTCACTTTAATCCGCGGTAAGTTTGAGAGAGCGGTTTGTGTTCTGCTGGTGAGGGCAGTTGATAGCAGATAATAATTAATGGCAGAGGGCAGCAGTAATCTGGGCAGTGCTCCTCCAGGAGACCCGCAGCTCATCGCGCTTATAGTGGAGCATCTGAAGAACAGAGGCCTGTTTGATGAGTTCAGGCGAGACTGTCTGGCAGACGTGGACACGAAGCCAGCTTATCAAAATCTGCGTCAGAAGGTGGACAACTTTGTGTCCACTCATCTCAGTACTCAAGAATGGAATCCATCCATCAACAAGAACCAAGTGAGGAATGTCTTGAGACAAAGCGTAGTTCAGTCAGGGATGTTGGAATCAGGGGTAGACCGAATCATTACTCAGGTGGTGGACCCTAAGCTAAACCATATCTTCAGGCCACACATCGAGGACGCCATTCATGATTTCCTAGCTGCAGAGAAGAAAGAAGAGGGCGCATCAAATTCAGCCCTCGAGGCTGAACAACAGGAAATGACTAGCAACACTGCAGCCAAAACACAATGAGGTAAA

Function

symbol description
bod1 Predicted to enable protein phosphatase 2A binding activity and protein phosphatase inhibitor activity. Predicted to be involved in negative regulation of phosphoprotein phosphatase activity. Predicted to act upstream of or within cell division. Predicted to be located in chromosome; cytoplasm; and cytoskeleton. Predicted to be part of outer kinetochore. Predicted to be active in centrosome; spindle microtubule; and spindle pole. Orthologous to human BOD1 (biorientation of chromosomes in cell division 1).

GO:

id name namespace
GO:0005856 cytoskeleton cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000040_03761247_03762668.mRNA True 557 mRNA 0.48 3 3761161 3762674

Neighbor

gene id symbol gene type direction distance location
CI01000040_03297317_03298657 DRD1B, DRD1 coding upstream 462265 3296455 ~ 3298896 (+)
CI01000040_03271519_03276006 NA coding upstream 485121 3271063 ~ 3276040 (+)
CI01000040_03212701_03215022 POU4F3 coding upstream 545993 3212701 ~ 3215168 (+)
CI01000040_03168337_03198400 RBM27 coding upstream 562761 3168337 ~ 3198400 (+)
CI01000040_02975088_02975548 NA coding upstream 785215 2975088 ~ 2975946 (+)
CI01000040_03789687_03800746 STC2B coding downstream 26407 3789081 ~ 3800746 (+)
CI01000040_03939728_03943493 RNF121 coding downstream 175634 3938308 ~ 3943624 (+)
CI01000040_04047210_04060876 NA coding downstream 284536 4047210 ~ 4061675 (+)
CI01000040_04063098_04068134 PPP2R2B coding downstream 300273 4062947 ~ 4068198 (+)
CI01000040_04369595_04374831 NA coding downstream 605791 4368465 ~ 4375355 (+)
G185877 NA non-coding upstream 34926 3725985 ~ 3726235 (+)
G185871 NA non-coding upstream 49610 3711244 ~ 3711551 (+)
G185818 NA non-coding upstream 120404 3561538 ~ 3640757 (+)
G185814 NA non-coding upstream 204800 3556072 ~ 3556361 (+)
G185764 NA non-coding upstream 207053 3495271 ~ 3554108 (+)
G185790 NA non-coding downstream 39545 3802219 ~ 3803713 (+)
G185912 NA non-coding downstream 103947 3866621 ~ 3866854 (+)
G185779 NA non-coding downstream 126750 3889424 ~ 3891659 (+)
G185914 NA non-coding downstream 130605 3893279 ~ 3893481 (+)
G185915 NA non-coding downstream 130811 3893485 ~ 3893687 (+)
G185884 NA other upstream 21880 3738987 ~ 3739281 (+)
G185296 NA other upstream 427178 3333578 ~ 3333983 (+)
G184003 NA other upstream 2524672 1230292 ~ 1236489 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other upstream 2782998 977184 ~ 978163 (+)
CI01000040_00240852_00305487 GABRB2 other upstream 3484306 240849 ~ 313275 (+)
G185947 NA other downstream 211091 3973765 ~ 3974123 (+)
G187510 NA other downstream 2206371 5969045 ~ 5971732 (+)
G188149 NA other downstream 3046017 6808691 ~ 6809130 (+)
CI01000040_06833701_06848731 NA other downstream 3075450 6832987 ~ 6849135 (+)

Expression


Co-expression Network