G183650


Basic Information

Item Value
gene id G183650
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 399662 ~ 399893 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU208550
CACCATTACTGACAATCCTCATTTTGGCTGCGTGAGATTCTCCAGCTTTGTTGTTGTTGAGCGACTGAAGCGTGAGCTGTTAAAGCTCTGCCCTCTTCCAGAAAGGGGGCCGGGAGCAGCAGCTCATTTGCATTTAAAGGGACACACACAAAAACAGTGTGTTTTTGCTCACACCCAAATAGGGGCAAATGAGACTCTTATTGCATCTTGTGAAAAGGGCATAATAGGTCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU208550 True 232 lncRNA 0.47 1 399662 399893

Neighbor

gene id symbol gene type direction distance location
CI01000040_00366809_00384965 NA coding upstream 14403 366709 ~ 385259 (+)
CI01000040_00347516_00350540 NA coding upstream 49061 347516 ~ 350601 (+)
CI01000040_00240852_00305487 GABRB2 coding upstream 94175 240849 ~ 313275 (+)
CI01000040_00178642_00181455 NA coding upstream 217471 178604 ~ 182404 (+)
CI01000040_00512880_00513451 NA coding downstream 112987 512880 ~ 513597 (+)
CI01000040_00554753_00561571 NA coding downstream 154860 554753 ~ 562993 (+)
CI01000040_00643738_00689792 STK32B, STK32A coding downstream 243845 643738 ~ 689918 (+)
CI01000040_00839831_00841736 NA coding downstream 439938 839831 ~ 841736 (+)
CI01000040_00849226_00851895 NA coding downstream 449333 849226 ~ 851915 (+)
G183649 NA non-coding upstream 358 399033 ~ 399304 (+)
G183630 NA non-coding upstream 2523 380608 ~ 397139 (+)
G183628 NA non-coding upstream 19213 380121 ~ 380449 (+)
G183603 NA non-coding upstream 41987 357433 ~ 357675 (+)
G183465 NA non-coding upstream 52748 346374 ~ 346914 (+)
G183705 NA non-coding downstream 49347 449240 ~ 449601 (+)
G183708 NA non-coding downstream 51825 451718 ~ 451946 (+)
G183724 NA non-coding downstream 80301 480194 ~ 480404 (+)
G183748 NA non-coding downstream 178956 578849 ~ 585744 (+)
G183757 NA non-coding downstream 194745 594638 ~ 598206 (+)
G183420 NA other upstream 234740 157543 ~ 164922 (+)
G183366 NA other upstream 339265 53691 ~ 60397 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other downstream 574220 977184 ~ 978163 (+)
G184003 NA other downstream 830399 1230292 ~ 1236489 (+)
G185296 NA other downstream 2933685 3333578 ~ 3333983 (+)
G185884 NA other downstream 3339094 3738987 ~ 3739281 (+)
G185947 NA other downstream 3573872 3973765 ~ 3974123 (+)

Expression


Co-expression Network