G183842


Basic Information

Item Value
gene id G183842
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 794759 ~ 794960 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU208759
AACCCAACTTGGGTTGTTTTTAATCAAGCATTTTTTAGAGTGTTTATAGTATAAAAATCATTTTGAACAAGTAATTTTTGTTCATTAACAAAATAAATGATAAATTCTTGTAAAAACCTTGATGTCCTTGTTTTCATTGTCTTCATGTCTATCTTGTAATGTTATAATCCACCACATATTTAATTTGAAGCAGATACATGTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU208759 True 202 lncRNA 0.26 1 794759 794960

Neighbor

gene id symbol gene type direction distance location
CI01000040_00643738_00689792 STK32B, STK32A coding upstream 104841 643738 ~ 689918 (+)
CI01000040_00554753_00561571 NA coding upstream 231766 554753 ~ 562993 (+)
CI01000040_00512880_00513451 NA coding upstream 281162 512880 ~ 513597 (+)
CI01000040_00366809_00384965 NA coding upstream 409500 366709 ~ 385259 (+)
CI01000040_00347516_00350540 NA coding upstream 444158 347516 ~ 350601 (+)
CI01000040_00839831_00841736 NA coding downstream 44871 839831 ~ 841736 (+)
CI01000040_00849226_00851895 NA coding downstream 54266 849226 ~ 851915 (+)
CI01000040_00863147_00874526 NA coding downstream 68187 863147 ~ 874546 (+)
CI01000040_00879146_00889251 NA coding downstream 84186 879146 ~ 889483 (+)
CI01000040_00895179_00895620 NA coding downstream 100219 895179 ~ 895649 (+)
G183776 NA non-coding upstream 36700 754019 ~ 758059 (+)
G183831 NA non-coding upstream 41509 752685 ~ 753250 (+)
G183830 NA non-coding upstream 42831 751570 ~ 751928 (+)
G183829 NA non-coding upstream 43286 751198 ~ 751473 (+)
G183828 NA non-coding upstream 43680 750775 ~ 751079 (+)
G183844 NA non-coding downstream 5454 800414 ~ 800757 (+)
G183846 NA non-coding downstream 12005 806965 ~ 807205 (+)
G183847 NA non-coding downstream 14805 809765 ~ 810023 (+)
G183849 NA non-coding downstream 26146 821106 ~ 823335 (+)
G183970 NA non-coding downstream 37345 832305 ~ 832856 (+)
CI01000040_00240852_00305487 GABRB2 other upstream 517904 240849 ~ 313275 (+)
G183420 NA other upstream 629837 157543 ~ 164922 (+)
G183366 NA other upstream 734362 53691 ~ 60397 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other downstream 179153 977184 ~ 978163 (+)
G184003 NA other downstream 435332 1230292 ~ 1236489 (+)
G185296 NA other downstream 2538618 3333578 ~ 3333983 (+)
G185884 NA other downstream 2944027 3738987 ~ 3739281 (+)
G185947 NA other downstream 3178805 3973765 ~ 3974123 (+)

Expression


Co-expression Network