G184124


Basic Information

Item Value
gene id G184124
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 1436940 ~ 1437293 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU209079
GCCAGCACAAATCCTCAGCTAAAGAAGTCACACAGTGAAATTGACACTAAAATCCATTGTAGCCTATATTATGAATCCAGAAGATTGCATGTTCGATTATATGCCTATGGATTAGTAATTACTCTAATAATCAGATATGGCGCGTTCATAATTGATATTAAGAATAATCTTATGTAACATTAAGACTGTACCACCAAAACCTGTCAGAACCAAACAAACGGGACCAGTGCACCAAATGTTAGGATAAAACAGATGTGCAGCATTGCAGTAAAGGTATGAAAACAACTCAGAAAGAGAGTGCGTTTCTCATGCACAACTGAGATTTGAAGTTTGTTCCACCCATTTTCAGGAACG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU209079 True 354 lncRNA 0.37 1 1436940 1437293

Neighbor

gene id symbol gene type direction distance location
CI01000040_01399805_01411103 ATG4A coding upstream 25265 1399805 ~ 1411675 (+)
CI01000040_01332036_01345122 FRMD7 coding upstream 91784 1332036 ~ 1345156 (+)
CI01000040_01296612_01311591 SEPT8, SEPT8A coding upstream 125319 1296612 ~ 1311621 (+)
CI01000040_01267267_01282224 NA coding upstream 154505 1267267 ~ 1282435 (+)
CI01000040_01206296_01212731 NA coding upstream 224209 1206128 ~ 1212731 (+)
CI01000040_01454703_01458555 GPR185A coding downstream 17410 1454703 ~ 1459283 (+)
CI01000040_01490929_01498480 NA coding downstream 53601 1490894 ~ 1498497 (+)
CI01000040_01535182_01539109 NA coding downstream 97807 1535100 ~ 1539460 (+)
CI01000040_01539717_01540595 NA coding downstream 102297 1539590 ~ 1540649 (+)
CI01000040_01540821_01545220 NA coding downstream 103461 1540754 ~ 1545260 (+)
G184117 NA non-coding upstream 11438 1425098 ~ 1425502 (+)
G184112 NA non-coding upstream 43398 1372172 ~ 1393542 (+)
G184009 NA non-coding upstream 48704 1348866 ~ 1388236 (+)
G184022 NA non-coding upstream 85563 1329959 ~ 1351377 (+)
G184005 NA non-coding upstream 256403 1162842 ~ 1180537 (+)
G184127 NA non-coding downstream 3266 1440559 ~ 1440781 (+)
G184161 NA non-coding downstream 86940 1524233 ~ 1530255 (+)
G184194 NA non-coding downstream 157016 1594309 ~ 1594820 (+)
G184198 NA non-coding downstream 163703 1600996 ~ 1601249 (+)
G184199 NA non-coding downstream 164421 1601714 ~ 1601944 (+)
G184003 NA other upstream 200451 1230292 ~ 1236489 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other upstream 458777 977184 ~ 978163 (+)
CI01000040_00240852_00305487 GABRB2 other upstream 1160085 240849 ~ 313275 (+)
G183420 NA other upstream 1272018 157543 ~ 164922 (+)
G183366 NA other upstream 1376543 53691 ~ 60397 (+)
G185296 NA other downstream 1896285 3333578 ~ 3333983 (+)
G185884 NA other downstream 2301694 3738987 ~ 3739281 (+)
G185947 NA other downstream 2536472 3973765 ~ 3974123 (+)
G187510 NA other downstream 4531752 5969045 ~ 5971732 (+)
G188149 NA other downstream 5371398 6808691 ~ 6809130 (+)

Expression


Co-expression Network