G184236


Basic Information

Item Value
gene id G184236
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 1698123 ~ 1698636 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU209225
ATTAAAATCGTGGCTTTAATGATTTAACGATGTTTTTAGTCGAATTTATTGAAAGCAGTTTACTCATCTACTTAATATGAAATAACATTTCTGTTCGTGACTTGTGCTGCTCGTTTCGGAGGATTACATAATGTTAAACAAGACTACAATTTGAAACCTTATGAATAACATTTCTGTAATTGTTTAACCATTTTGTAATATTTAGTTTGTTTGCTGTGAGACACAGAAGGCGTTTTCTCCTATGCAGCGACTGACAATACAACCATAAGATACACCAAAACACAACATAAATTCACAAATAACATCCATTTTATTTGTTCGCTGTACTCCAAATCTTTAGAATCCATATGTTTGTAAGGAACAGATCCAAATTCAGCCCTTTATCCATCGATCTTCATCTTCATTCTCAGCAACAGCGACCGTCACAGCTCGCGCTCGTTATGATTCAAATTTGAAAGTAGCGCCACCCTCGAGAAGCGTTACGACATGGTTTACGGCACTGATATCGAACGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU209225 True 514 lncRNA 0.36 1 1698123 1698636

Neighbor

gene id symbol gene type direction distance location
CI01000040_01604128_01609619 DKC1, DKC1.L coding upstream 88409 1604128 ~ 1609714 (+)
CI01000040_01579092_01597460 TMLHE coding upstream 99643 1579012 ~ 1598480 (+)
CI01000040_01553258_01557964 NA coding upstream 137956 1553258 ~ 1560167 (+)
CI01000040_01540821_01545220 NA coding upstream 152863 1540754 ~ 1545260 (+)
CI01000040_01539717_01540595 NA coding upstream 157474 1539590 ~ 1540649 (+)
CI01000040_01706518_01706939 NA coding downstream 7882 1706518 ~ 1707234 (+)
CI01000040_01707444_01725985 NA coding downstream 8645 1707281 ~ 1725985 (+)
CI01000040_01728828_01731709 KIF4A coding downstream 29136 1727772 ~ 1732232 (+)
CI01000040_01760148_01802721 AMMECR1 coding downstream 61512 1760148 ~ 1803002 (+)
CI01000040_01876498_01878546 FUNDC2 coding downstream 177862 1876498 ~ 1879308 (+)
G184235 NA non-coding upstream 2169 1695593 ~ 1695954 (+)
G184234 NA non-coding upstream 3923 1693802 ~ 1694200 (+)
G184231 NA non-coding upstream 6364 1691422 ~ 1691759 (+)
G184229 NA non-coding upstream 8456 1689456 ~ 1689667 (+)
G184187 NA non-coding upstream 63191 1622549 ~ 1634932 (+)
G184268 NA non-coding downstream 171497 1870133 ~ 1870342 (+)
G184276 NA non-coding downstream 198596 1897232 ~ 1897596 (+)
G184295 NA non-coding downstream 247853 1946489 ~ 1946692 (+)
G184297 NA non-coding downstream 257893 1956529 ~ 1956873 (+)
G184324 NA non-coding downstream 329445 2028081 ~ 2112062 (+)
G184003 NA other upstream 461634 1230292 ~ 1236489 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other upstream 719960 977184 ~ 978163 (+)
CI01000040_00240852_00305487 GABRB2 other upstream 1421268 240849 ~ 313275 (+)
G183420 NA other upstream 1533201 157543 ~ 164922 (+)
G183366 NA other upstream 1637726 53691 ~ 60397 (+)
G185296 NA other downstream 1634942 3333578 ~ 3333983 (+)
G185884 NA other downstream 2040351 3738987 ~ 3739281 (+)
G185947 NA other downstream 2275129 3973765 ~ 3974123 (+)
G187510 NA other downstream 4270409 5969045 ~ 5971732 (+)
G188149 NA other downstream 5110055 6808691 ~ 6809130 (+)

Expression


Co-expression Network