G189501


Basic Information

Item Value
gene id G189501
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000043
NCBI id null
chromosome length 7746009
location 832940 ~ 840609 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU215239
CAGGAAGCTTGCCGCTTTTTTATCGGATACCACGTAGTCTACTATCCAGATATCATCGATATATACCAATACCGACAGGTCTATCTCTTTTGAATGTAAAATTTTTGCGATTTCTGAGAATAAAACAGATTATAAAGAACATTTGAAGATCCATGGCATTCCAGATCCAAGTAAGAGTTCCTGTTCCAGTTCCAGTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU215239 True 197 lncRNA 0.37 2 832940 840609

Neighbor

gene id symbol gene type direction distance location
CI01000043_00814611_00818100 NA coding upstream 13419 814552 ~ 819521 (+)
CI01000043_00776707_00791897 NA coding upstream 41009 776241 ~ 791931 (+)
CI01000043_00755986_00763327 LGI2A, LGI2 coding upstream 68994 755841 ~ 763946 (+)
CI01000043_00732508_00746912 SEPSECS coding upstream 84773 732508 ~ 748167 (+)
CI01000043_00713100_00730032 ACO1 coding upstream 100897 713100 ~ 732043 (+)
CI01000043_00872741_00876715 NA coding downstream 32132 872741 ~ 876985 (+)
CI01000043_00878804_00886856 NA coding downstream 38195 878804 ~ 886970 (+)
CI01000043_00898380_00913554 NA coding downstream 57771 898380 ~ 913647 (+)
CI01000043_00930835_00959810 BRAFLDRAFT_59675, DHX15 coding downstream 89720 930329 ~ 960211 (+)
CI01000043_01366462_01369312 NA coding downstream 525853 1366462 ~ 1379702 (+)
G189413 NA non-coding upstream 143180 687473 ~ 689760 (+)
G189416 NA non-coding upstream 145559 687003 ~ 687381 (+)
G189425 NA non-coding upstream 168259 658279 ~ 664681 (+)
G189410 NA non-coding upstream 193062 639576 ~ 639878 (+)
G189528 NA non-coding downstream 9189 849798 ~ 855569 (+)
G189530 NA non-coding downstream 13878 854487 ~ 854813 (+)
G189552 NA non-coding downstream 77801 918410 ~ 919428 (+)
G189554 NA non-coding downstream 80238 920847 ~ 921656 (+)
G189555 NA non-coding downstream 81707 922316 ~ 922516 (+)
G190241 NA other downstream 842947 1683556 ~ 1692479 (+)
G190272 NA other downstream 1601253 2441862 ~ 2443710 (+)
G191670 NA other downstream 3062624 3903233 ~ 3909966 (+)
G191644 NA other downstream 3467339 4307948 ~ 4350614 (+)
G192454 NA other downstream 4152404 4993013 ~ 4993356 (+)

Expression


Co-expression Network