G190849


Basic Information

Item Value
gene id G190849
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000043
NCBI id null
chromosome length 7746009
location 2495474 ~ 2495688 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU216765
CTTTCATTTCATGAATTATATCTTAGTTTGTTTTTCTTTTAAGTTTTTTAAGATGTGAAGTACACTTCAAGTGCAAGTTCAACATTAAGCACTCTTAATTTTCACAAGACATATTTCAGTAGGCAATATATTAGCAGTCAATTCTGAACATATGTCCACTCTAGAGTATTTATTTTCTCATGTAACCACTAGAGGGAGCTAACCTTGATTTCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU216765 True 215 lncRNA 0.31 1 2495474 2495688

Neighbor

gene id symbol gene type direction distance location
CI01000043_02443106_02445250 MARVELD3 coding downstream 49167 2442964 ~ 2446307 (-)
CI01000043_02302020_02310202 ZNF821 coding downstream 185272 2301573 ~ 2310202 (-)
CI01000043_02267429_02272738 ELP5 coding downstream 222736 2267201 ~ 2272738 (-)
CI01000043_02252982_02264248 CTDNEP1B, CTDNEP1A, CTDNEP1, DULDA coding downstream 231226 2251846 ~ 2264248 (-)
CI01000043_02245322_02249390 GABARAPL1, GABARAP.L, GABARAP, GABARAPA, GABARAPB, BRAFLDRAFT_122660, GBRAP coding downstream 246019 2244688 ~ 2249480 (-)
CI01000043_02555479_02574821 HNF4B coding upstream 59586 2555274 ~ 2574821 (-)
CI01000043_02725571_02730393 NA coding upstream 229464 2725152 ~ 2730860 (-)
CI01000043_02868129_02876445 NA coding upstream 371728 2867416 ~ 2876465 (-)
CI01000043_02912881_02924260 NA coding upstream 417188 2912876 ~ 2924415 (-)
CI01000043_03133480_03136057 NA coding upstream 637741 3133429 ~ 3136325 (-)
G190847 NA non-coding downstream 942 2494309 ~ 2494532 (-)
G190846 NA non-coding downstream 1759 2493379 ~ 2493715 (-)
G190845 NA non-coding downstream 2445 2492793 ~ 2493029 (-)
G190844 NA non-coding downstream 2994 2492221 ~ 2492480 (-)
G190829 NA non-coding downstream 43865 2451329 ~ 2451609 (-)
G190861 NA non-coding upstream 31492 2527180 ~ 2527693 (-)
G190869 NA non-coding upstream 52382 2548070 ~ 2548300 (-)
G190873 NA non-coding upstream 98626 2594314 ~ 2594592 (-)
G191299 NA non-coding upstream 384708 2880396 ~ 2884547 (-)
G191483 NA non-coding upstream 655143 3150831 ~ 3151071 (-)
G189881 NA other downstream 1612306 814747 ~ 883168 (-)
G191296 NA other upstream 552684 3048372 ~ 3049864 (-)
G192109 NA other upstream 1836223 4331911 ~ 4332726 (-)
G192980 NA other upstream 2960809 5456497 ~ 5458414 (-)
G192947 NA other upstream 3097993 5593681 ~ 5618440 (-)
G193313 NA other upstream 3759884 6255572 ~ 6256279 (-)

Expression


Co-expression Network