G191489



Basic Information


Item Value
gene id G191489
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000043
NCBI id null
chromosome length 7746009
location 3167897 ~ 3168172 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU217466
CAGCCTTTAGCCTCCTCGTTAGAGCGTCCGACTCCCACACCGGAGACCCAGGTTCGAGGCCCGTGCAGAGTGGGGCGAGTAGGACCGGGGTTACATTGGTGCCGTGACCCAGATGGGAGTGAGGTTTAGGGGGGTGAGTGTAACGGAGGCCAGCTAGTAGTTGCTGTGCAAGTAAACCTCACTCCTCTGATCTCAAGAGATGCTCTAGCGACTGACGCTAGAGGTCGCACCCTTTAGCCTCCTCGTTAAAGCGTCCGACTCCCACGCCAGAAACCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU217466 True 276 lncRNA 0.59 1 3167897 3168172

Neighbor


gene id symbol gene type direction distance location
CI01000043_03138222_03139281 NA coding downstream 28264 3137166 ~ 3139633 (-)
CI01000043_03133480_03136057 NA coding downstream 31572 3133429 ~ 3136325 (-)
CI01000043_02912881_02924260 NA coding downstream 243482 2912876 ~ 2924415 (-)
CI01000043_02868129_02876445 NA coding downstream 291432 2867416 ~ 2876465 (-)
CI01000043_02725571_02730393 NA coding downstream 437037 2725152 ~ 2730860 (-)
CI01000043_03325623_03351622 DHX38 coding upstream 157216 3325388 ~ 3353062 (-)
CI01000043_03356337_03361772 CYB5B coding upstream 187879 3356051 ~ 3363143 (-)
CI01000043_03377513_03382227 NA coding upstream 208733 3376905 ~ 3382425 (-)
CI01000043_03452739_03529381 CPNE7 coding upstream 283419 3451591 ~ 3529693 (-)
CI01000043_03539141_03543311 CASC3.L, RPL13.S, RPL13 coding upstream 370933 3539105 ~ 3543892 (-)
G191483 NA non-coding downstream 16826 3150831 ~ 3151071 (-)
G191299 NA non-coding downstream 283350 2880396 ~ 2884547 (-)
G190873 NA non-coding downstream 573305 2594314 ~ 2594592 (-)
G190869 NA non-coding downstream 619597 2548070 ~ 2548300 (-)
G190861 NA non-coding downstream 640204 2527180 ~ 2527693 (-)
G191491 NA non-coding upstream 2198 3170370 ~ 3170592 (-)
G191506 NA non-coding upstream 42565 3210737 ~ 3213930 (-)
G191510 NA non-coding upstream 47977 3216149 ~ 3216495 (-)
G191511 NA non-coding upstream 48497 3216669 ~ 3216870 (-)
G191517 NA non-coding upstream 63921 3232093 ~ 3232326 (-)
G191296 NA other downstream 118033 3048372 ~ 3049864 (-)
CI01000043_02245322_02249390 GABARAPL1, GABARAP.L, GABARAP, GABARAPA, GABARAPB, BRAFLDRAFT_122660, GBRAP other downstream 918417 2244688 ~ 2249480 (-)
G189881 NA other downstream 2284729 814747 ~ 883168 (-)
G192109 NA other upstream 1163739 4331911 ~ 4332726 (-)
G192980 NA other upstream 2288325 5456497 ~ 5458414 (-)
G192947 NA other upstream 2425509 5593681 ~ 5618440 (-)
G193313 NA other upstream 3087400 6255572 ~ 6256279 (-)
G193922 NA other upstream 3395168 6563340 ~ 6566039 (-)

Expression



Co-expression Network