G191539


Basic Information

Item Value
gene id G191539
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000043
NCBI id null
chromosome length 7746009
location 3281072 ~ 3281308 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU217517
CGTGTCTCTGCAGGTGTCGTGAGCCTCCTTCAGTTGTTCTCTGAGCTGAAGCAGCTGTGTTTTGAGTGAGGCACACTCCTTCTCCCTCTGCCTTTTCTCTTTCTTGGCTCTCTGCAGATCAGCTTCCAGCCCTCGAGCAGAGATAGCCTGCTTCTCTGCCTCTGCCGCCCTGCTTCGGATCTTCTCCCGTGCCTGCAGAAGATCAGCCTCGGACTGTCTCAGTAGGGCGTCTCTCTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU217517 True 237 lncRNA 0.56 1 3281072 3281308

Neighbor

gene id symbol gene type direction distance location
CI01000043_03138222_03139281 NA coding downstream 141439 3137166 ~ 3139633 (-)
CI01000043_03133480_03136057 NA coding downstream 144747 3133429 ~ 3136325 (-)
CI01000043_02912881_02924260 NA coding downstream 356657 2912876 ~ 2924415 (-)
CI01000043_02868129_02876445 NA coding downstream 404607 2867416 ~ 2876465 (-)
CI01000043_02725571_02730393 NA coding downstream 550212 2725152 ~ 2730860 (-)
CI01000043_03325623_03351622 DHX38 coding upstream 44080 3325388 ~ 3353062 (-)
CI01000043_03356337_03361772 CYB5B coding upstream 74743 3356051 ~ 3363143 (-)
CI01000043_03377513_03382227 NA coding upstream 95597 3376905 ~ 3382425 (-)
CI01000043_03452739_03529381 CPNE7 coding upstream 170283 3451591 ~ 3529693 (-)
CI01000043_03539141_03543311 CASC3.L, RPL13.S, RPL13 coding upstream 257797 3539105 ~ 3543892 (-)
G191538 NA non-coding downstream 8810 3272026 ~ 3272262 (-)
G191537 NA non-coding downstream 9844 3270999 ~ 3271228 (-)
G191536 NA non-coding downstream 24645 3256202 ~ 3256427 (-)
G191535 NA non-coding downstream 26800 3253967 ~ 3254272 (-)
G191534 NA non-coding downstream 27797 3253075 ~ 3253275 (-)
G191569 NA non-coding upstream 146169 3427477 ~ 3427776 (-)
G191582 NA non-coding upstream 256962 3538270 ~ 3538681 (-)
G191601 NA non-coding upstream 366741 3648049 ~ 3648332 (-)
G191620 NA non-coding upstream 415263 3696571 ~ 3703622 (-)
G191627 NA non-coding upstream 424849 3706157 ~ 3712416 (-)
G191296 NA other downstream 231208 3048372 ~ 3049864 (-)
CI01000043_02245322_02249390 GABARAPL1, GABARAP.L, GABARAP, GABARAPA, GABARAPB, BRAFLDRAFT_122660, GBRAP other downstream 1031592 2244688 ~ 2249480 (-)
G189881 NA other downstream 2397904 814747 ~ 883168 (-)
G192109 NA other upstream 1050603 4331911 ~ 4332726 (-)
G192980 NA other upstream 2175189 5456497 ~ 5458414 (-)
G192947 NA other upstream 2312373 5593681 ~ 5618440 (-)
G193313 NA other upstream 2974264 6255572 ~ 6256279 (-)
G193922 NA other upstream 3282032 6563340 ~ 6566039 (-)

Expression


Co-expression Network