G192688


Basic Information

Item Value
gene id G192688
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000043
NCBI id null
chromosome length 7746009
location 4635222 ~ 4635468 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU218771
GCTTAAGCTAGTCCTAGACTAAAATGCATGTTTGAACTGTTTCAACTGAAAGAAACTTGCTCTGAGATATCTCAAAATATGTCAGTGCAATTGTTTTGTCTCAAGATGCACATCAGTAATATTTTTTTCTAAGACACGCTTATAAAAGTTACTTAAATGCCCTAATTGAACTAAGGCCTAATCCTGGCTTAGGCTAAGCCCTGTCTGTGAATTCGGGCCTTGAACTTAAAACAGTCGTCACATAAAC

Function

NR:

description
PREDICTED: uncharacterized protein LOC107720873

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU218771 True 247 lncRNA 0.37 1 4635222 4635468

Neighbor

gene id symbol gene type direction distance location
CI01000043_04486893_04491014 CCND1.L, CCND1, CCND1.S coding downstream 143234 4486601 ~ 4491988 (-)
CI01000043_04297368_04337304 NA coding downstream 297918 4296824 ~ 4337304 (-)
CI01000043_04292518_04294909 NA coding downstream 340313 4292183 ~ 4294909 (-)
CI01000043_04185319_04204509 CSNK1G1 coding downstream 430181 4185108 ~ 4205041 (-)
CI01000043_04168896_04172758 RS17, RPS17.S, RPS17 coding downstream 462464 4168871 ~ 4172758 (-)
CI01000043_04701996_04719324 TPCN2 coding upstream 66528 4701996 ~ 4719324 (-)
CI01000043_04725324_04728884 NA coding upstream 89601 4725069 ~ 4728884 (-)
CI01000043_04738890_04742485 NA coding upstream 103422 4738890 ~ 4743454 (-)
CI01000043_04821316_04858515 MMP15 coding upstream 185606 4818251 ~ 4859482 (-)
CI01000043_04920619_04925317 FAM60AL, FA60A coding upstream 284926 4920394 ~ 4925317 (-)
G192684 NA non-coding downstream 2679 4632300 ~ 4632543 (-)
G192671 NA non-coding downstream 17191 4617697 ~ 4618031 (-)
G192243 NA non-coding downstream 94777 4539694 ~ 4540445 (-)
G192163 NA non-coding downstream 209429 4425466 ~ 4425793 (-)
G192138 NA non-coding downstream 234988 4399946 ~ 4400234 (-)
G192691 NA non-coding upstream 4352 4639820 ~ 4640119 (-)
G192702 NA non-coding upstream 38419 4673887 ~ 4674182 (-)
G192703 NA non-coding upstream 39800 4675268 ~ 4675494 (-)
G192704 NA non-coding upstream 40065 4675533 ~ 4675842 (-)
G192707 NA non-coding upstream 51525 4686993 ~ 4687297 (-)
G192109 NA other downstream 302496 4331911 ~ 4332726 (-)
G191296 NA other downstream 1585358 3048372 ~ 3049864 (-)
CI01000043_02245322_02249390 GABARAPL1, GABARAP.L, GABARAP, GABARAPA, GABARAPB, BRAFLDRAFT_122660, GBRAP other downstream 2385742 2244688 ~ 2249480 (-)
G189881 NA other downstream 3752054 814747 ~ 883168 (-)
G192980 NA other upstream 821029 5456497 ~ 5458414 (-)
G192947 NA other upstream 958213 5593681 ~ 5618440 (-)
G193313 NA other upstream 1620104 6255572 ~ 6256279 (-)
G193922 NA other upstream 1927872 6563340 ~ 6566039 (-)
G194100 NA other upstream 2795418 7494997 ~ 7498973 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
tiger barb (Puntius tetrazona) G164500 NA non-coding NC_056722.1 CM032091.1 20594633 ~ 20595605 (-)