G193843



Basic Information


Item Value
gene id G193843
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000043
NCBI id null
chromosome length 7746009
location 6325783 ~ 6327302 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU220092
TGTAAGCGGCCATCAGACACAATAATGAGGAGCTCATCAGAAAATGGAATATAATGTGTAATTTGTATTTGTGTATAGAGGGTCACCATTGGTCCAATATTTTTTTTCTTTAATGAAAAACATGGTAAGTTTTGTTGAATCTATGTTAGGTTTAAATAAAAACCATTGGATTTGTTAATGAAATATGTCTCTTCATTAGTGTTGTTACATTTTATTTATTTTAATGGCCTTGAAAACAAATG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU220092 True 242 lncRNA 0.29 3 6325783 6327302

Neighbor


gene id symbol gene type direction distance location
CI01000043_06302312_06306588 NA coding downstream 19152 6302090 ~ 6306631 (-)
CI01000043_06269503_06272443 NA coding downstream 53340 6269380 ~ 6272443 (-)
CI01000043_06225443_06244661 NA coding downstream 81122 6224972 ~ 6244661 (-)
CI01000043_06218733_06222025 NA coding downstream 103015 6218733 ~ 6222768 (-)
CI01000043_06204424_06208220 NA coding downstream 117563 6204403 ~ 6208220 (-)
CI01000043_06393054_06405683 CSK22, CSNK2A2B, CSNK2A2.L, CSNK2A2, CSNK2A2A coding upstream 65422 6392724 ~ 6405683 (-)
CI01000043_06408340_06410360 ZNF319 coding upstream 80783 6408085 ~ 6412619 (-)
CI01000043_06418312_06429795 JPH3 coding upstream 90788 6418090 ~ 6430039 (-)
CI01000043_06454177_06466545 DRD4B coding upstream 126152 6453454 ~ 6466698 (-)
CI01000043_06496689_06498999 RXFP3.3A2 coding upstream 169308 6496610 ~ 6499071 (-)
G193842 NA non-coding downstream 184 6325361 ~ 6325599 (-)
G193841 NA non-coding downstream 547 6324807 ~ 6325236 (-)
G193823 NA non-coding downstream 3162 6311793 ~ 6322621 (-)
G193806 NA non-coding downstream 26458 6297232 ~ 6299325 (-)
G193805 NA non-coding downstream 31002 6291288 ~ 6294781 (-)
G193849 NA non-coding upstream 15858 6343160 ~ 6343436 (-)
G193854 NA non-coding upstream 20003 6347305 ~ 6347575 (-)
G193855 NA non-coding upstream 20346 6347648 ~ 6347904 (-)
G193857 NA non-coding upstream 21332 6348634 ~ 6348919 (-)
G193858 NA non-coding upstream 21742 6349044 ~ 6349298 (-)
G193313 NA other downstream 69504 6255572 ~ 6256279 (-)
G192947 NA other downstream 707343 5593681 ~ 5618440 (-)
G192980 NA other downstream 867369 5456497 ~ 5458414 (-)
G192109 NA other downstream 1993057 4331911 ~ 4332726 (-)
G191296 NA other downstream 3275919 3048372 ~ 3049864 (-)
G193922 NA other upstream 236038 6563340 ~ 6566039 (-)
G194100 NA other upstream 1103584 7494997 ~ 7498973 (-)

Expression



Co-expression Network