G193858



Basic Information


Item Value
gene id G193858
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000043
NCBI id null
chromosome length 7746009
location 6349044 ~ 6349298 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU220108
AAGCATTTTAGCGCTAAAACTAGCTCCTAAATCTGTGAAACGCTAGGAGTAGTCAAGAGGACTCGTAAGTCACTAAGACCAAATCAAAAACAGTCCTAAAATGATTGTTGGTGCCAATCCGCTTTAGCAATCCACCCAAAGACACTGTACACCATTGAAGCAATAGCGATAGAGCCTTGGGGGCAGTAGTGCAATACGGAGCAGGAAGAGCAAAAACAGCAGAAACTTAACGAACATGAAAAACAGCTTGTTCAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU220108 True 255 lncRNA 0.43 1 6349044 6349298

Neighbor


gene id symbol gene type direction distance location
CI01000043_06302312_06306588 NA coding downstream 42413 6302090 ~ 6306631 (-)
CI01000043_06269503_06272443 NA coding downstream 76601 6269380 ~ 6272443 (-)
CI01000043_06225443_06244661 NA coding downstream 104383 6224972 ~ 6244661 (-)
CI01000043_06218733_06222025 NA coding downstream 126276 6218733 ~ 6222768 (-)
CI01000043_06204424_06208220 NA coding downstream 140824 6204403 ~ 6208220 (-)
CI01000043_06393054_06405683 CSK22, CSNK2A2B, CSNK2A2.L, CSNK2A2, CSNK2A2A coding upstream 43426 6392724 ~ 6405683 (-)
CI01000043_06408340_06410360 ZNF319 coding upstream 58787 6408085 ~ 6412619 (-)
CI01000043_06418312_06429795 JPH3 coding upstream 68792 6418090 ~ 6430039 (-)
CI01000043_06454177_06466545 DRD4B coding upstream 104156 6453454 ~ 6466698 (-)
CI01000043_06496689_06498999 RXFP3.3A2 coding upstream 147312 6496610 ~ 6499071 (-)
G193857 NA non-coding downstream 125 6348634 ~ 6348919 (-)
G193855 NA non-coding downstream 1140 6347648 ~ 6347904 (-)
G193854 NA non-coding downstream 1469 6347305 ~ 6347575 (-)
G193849 NA non-coding downstream 5608 6343160 ~ 6343436 (-)
G193843 NA non-coding downstream 21742 6325783 ~ 6327302 (-)
G193859 NA non-coding upstream 196 6349494 ~ 6349693 (-)
G193861 NA non-coding upstream 1016 6350314 ~ 6351742 (-)
G193862 NA non-coding upstream 2478 6351776 ~ 6352021 (-)
G193863 NA non-coding upstream 2819 6352117 ~ 6352356 (-)
G193895 NA non-coding upstream 144095 6493393 ~ 6493635 (-)
G193313 NA other downstream 92765 6255572 ~ 6256279 (-)
G192947 NA other downstream 730604 5593681 ~ 5618440 (-)
G192980 NA other downstream 890630 5456497 ~ 5458414 (-)
G192109 NA other downstream 2016318 4331911 ~ 4332726 (-)
G191296 NA other downstream 3299180 3048372 ~ 3049864 (-)
G193922 NA other upstream 214042 6563340 ~ 6566039 (-)
G194100 NA other upstream 1081588 7494997 ~ 7498973 (-)

Expression



Co-expression Network