G193895


Basic Information

Item Value
gene id G193895
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000043
NCBI id null
chromosome length 7746009
location 6493393 ~ 6493635 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU220173
GGCATGATACGACAATTCTTGAAAAATTTTACGTAATCAGATTACTTTTTTCAAGTAACTAGTAAAGAAACACATTACTTTTAAATTTACAACAAAATATCTGAGTTACTTTTTCGAATACGTAACGCAAGTTATTTTGTTTTCCCATCATATTGACTGACAGCTCCTCTGTTCCCATGTTGAGAGAAATCTGGAGTGAGTGCAGAGGCGTTGTGTGCACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU220173 True 221 lncRNA 0.35 2 6493393 6493635

Neighbor

gene id symbol gene type direction distance location
CI01000043_06454177_06466545 DRD4B coding downstream 26695 6453454 ~ 6466698 (-)
CI01000043_06418312_06429795 JPH3 coding downstream 63354 6418090 ~ 6430039 (-)
CI01000043_06408340_06410360 ZNF319 coding downstream 80774 6408085 ~ 6412619 (-)
CI01000043_06393054_06405683 CSK22, CSNK2A2B, CSNK2A2.L, CSNK2A2, CSNK2A2A coding downstream 87710 6392724 ~ 6405683 (-)
CI01000043_06302312_06306588 NA coding downstream 186762 6302090 ~ 6306631 (-)
CI01000043_06496689_06498999 RXFP3.3A2 coding upstream 2975 6496610 ~ 6499071 (-)
CI01000043_06587352_06594218 ENOSF1 coding upstream 93674 6587309 ~ 6594358 (-)
CI01000043_06600284_06605957 SCAMP2L coding upstream 106649 6600284 ~ 6605957 (-)
CI01000043_06608949_06716808 MYO9AA coding upstream 115314 6608949 ~ 6716808 (-)
CI01000043_06764034_06770845 IST1 coding upstream 269278 6762913 ~ 6770845 (-)
G193863 NA non-coding downstream 141037 6352117 ~ 6352356 (-)
G193862 NA non-coding downstream 141372 6351776 ~ 6352021 (-)
G193861 NA non-coding downstream 141651 6350314 ~ 6351742 (-)
G193859 NA non-coding downstream 143700 6349494 ~ 6349693 (-)
G193858 NA non-coding downstream 144095 6349044 ~ 6349298 (-)
G193907 NA non-coding upstream 46378 6540013 ~ 6542839 (-)
G194100 NA non-coding upstream 934831 7494997 ~ 7498973 (-)
G194116 NA non-coding upstream 998310 7491945 ~ 7724924 (-)
G194120 NA non-coding upstream 1020228 7513863 ~ 7560313 (-)
G194109 NA non-coding upstream 1038157 7531792 ~ 7730635 (-)
G193313 NA other downstream 237114 6255572 ~ 6256279 (-)
G192947 NA other downstream 874953 5593681 ~ 5618440 (-)
G192980 NA other downstream 1034979 5456497 ~ 5458414 (-)
G192109 NA other downstream 2160667 4331911 ~ 4332726 (-)
G191296 NA other downstream 3443529 3048372 ~ 3049864 (-)
G193922 NA other upstream 69705 6563340 ~ 6566039 (-)

Expression


Co-expression Network