CI01000046_03964744_03965521 (SHMT1)


Basic Information

Item Value
gene id CI01000046_03964744_03965521
gene name SHMT1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 3964744 ~ 3965543 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000046_03964744_03965521.mRNA
ATGGAAAAGGGCTACAAAGTTGTTACAGGTGATAAAAGTGCCTTGCGCCCAAGCGGCCTTCGTTTAGGATCTCCTGCTCTTACATCTCGAGGACTATTGGAGGACGATTTCCATAAGGTTGCCGAGTTCATTCACCAGGGCATTGAGTTGACATTGGAGATACAAAGAAACATGAATCCTAAAGCAACTTTGAAGGAGTTTAAAGAGGAACTGGCACAAAATGAGAAGTACCAACTGAAAATAAACAAAATCCGAAAGGAAGTTGAAGACTTTTCTGGAAAGTTCCCAATGCCTGGGTTGCCGGAGTTATAATTAGTCTGAATTAATGACTGAA

Function

symbol description
shmt1 Enables glycine hydroxymethyltransferase activity. Predicted to be involved in several processes, including L-serine metabolic process; folic acid-containing compound metabolic process; and protein homotetramerization. Predicted to act upstream of or within methylation. Located in cytosol and nucleus. Is expressed in several structures, including digestive system; immature eye; midbrain; neural tube; and oocyte. Human ortholog(s) of this gene implicated in breast cancer. Orthologous to human SHMT1 (serine hydroxymethyltransferase 1).

NR:

description
Shmt1 protein

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K00600 glyA, SHMT; glycine hydroxymethyltransferase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000046_03964744_03965521.mRNA True 334 mRNA 0.42 3 3964744 3965543

Neighbor

gene id symbol gene type direction distance location
CI01000046_03959320_03963204 SHMT1 coding upstream 1540 3958548 ~ 3963204 (+)
CI01000046_03953528_03957334 PDAP1B, PDAP1 coding upstream 7049 3953105 ~ 3957695 (+)
CI01000046_03943890_03945302 ATP5J2 coding upstream 19372 3943794 ~ 3945500 (+)
CI01000046_03887074_03887701 NA coding upstream 76705 3886910 ~ 3888039 (+)
CI01000046_03794654_03799486 ACTG1, ACTL9, ACTB2, ACTB1, ACTB, ACTBB coding upstream 164718 3793720 ~ 3800026 (+)
CI01000046_03971520_03980002 TOP3A coding downstream 5977 3971520 ~ 3980102 (+)
CI01000046_03982069_03996142 FLII, FLII.S coding downstream 16526 3982069 ~ 3997163 (+)
CI01000046_03998572_04009276 ZNF598 coding downstream 33029 3998572 ~ 4010216 (+)
CI01000046_04024795_04028000 DRG2 coding downstream 59008 4024551 ~ 4028000 (+)
CI01000046_04040958_04080846 NA coding downstream 74480 4040023 ~ 4081319 (+)
G197039 NA non-coding upstream 13916 3950585 ~ 3950828 (+)
G197024 NA non-coding upstream 49907 3914584 ~ 3914837 (+)
G196887 NA non-coding upstream 72903 3891020 ~ 3891841 (+)
G196994 NA non-coding upstream 192666 3771842 ~ 3772078 (+)
G196846 NA non-coding upstream 320046 3644183 ~ 3644698 (+)
G196871 NA non-coding downstream 160455 4125998 ~ 4126444 (+)
G196867 NA non-coding downstream 161334 4126877 ~ 4127188 (+)
G197051 NA non-coding downstream 162070 4127613 ~ 4128009 (+)
G196870 NA non-coding downstream 162962 4128505 ~ 4128795 (+)
G197052 NA non-coding downstream 168745 4134288 ~ 4137233 (+)
G196936 NA other upstream 770473 3186995 ~ 3194271 (+)
CI01000046_02451052_02454565 MAFK other upstream 1507464 2442395 ~ 2457280 (+)
CI01000046_01865451_01881353 NA other upstream 2005596 1865451 ~ 1881369 (+)
CI01000046_01540075_01668012 HS3ST4 other upstream 2401407 1539494 ~ 1668012 (+)
G197055 NA other downstream 183880 4149423 ~ 4149780 (+)
G197121 NA other downstream 405468 4371011 ~ 4371430 (+)
G196869 NA other downstream 449987 4415530 ~ 4421687 (+)
G197352 NA other downstream 1308839 5259318 ~ 5276453 (+)
G197528 NA other downstream 1760578 5726121 ~ 5742684 (+)

Expression


Co-expression Network