G195038


Basic Information

Item Value
gene id G195038
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 1206445 ~ 1208328 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU221530
TGTCTGCCCCTGACGTTGAAACCCTTATTTTCATTGTAAATAAACTTTGTATTGATTTTGATATCTCTCTGGTATTGAGACTCACTTCCTTTCTGTTACGGCTCACCCCTAGCAGTCGTAACAAGTGATATATTCAATTTTTATATTCATATAAATACAAACCCGATTAGGACTGAATTATTGAGCTAGCATCTTCATTATCAGTAACACCATAAGCAATGCAAACCATTGCATTTTGGTTTTGCTTCAGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU221530 True 252 lncRNA 0.35 2 1206445 1208328

Neighbor

gene id symbol gene type direction distance location
CI01000046_01149090_01159654 NA coding upstream 46343 1148936 ~ 1160102 (+)
CI01000046_01067894_01070331 H3F3AP4, H3F3C, H3F3B, H3F3A, GM6421 coding upstream 135668 1066936 ~ 1070777 (+)
CI01000046_01026787_01028640 IGFALS coding upstream 177576 1026502 ~ 1028869 (+)
CI01000046_00893353_00931079 SHISA9B coding upstream 274002 893299 ~ 932443 (+)
CI01000046_00784993_00786387 NA coding upstream 419365 784645 ~ 787080 (+)
CI01000046_01246234_01251650 NA coding downstream 37404 1245732 ~ 1251689 (+)
CI01000046_01255895_01262232 NA coding downstream 47567 1255895 ~ 1262547 (+)
CI01000046_01275798_01283718 PDPK1A coding downstream 67470 1275798 ~ 1284100 (+)
CI01000046_01289846_01293954 KCTD5A, KCTD5 coding downstream 81240 1289568 ~ 1294336 (+)
CI01000046_01318513_01343464 USP31 coding downstream 108342 1316670 ~ 1344195 (+)
G195018 NA non-coding upstream 49113 1157127 ~ 1157332 (+)
G195015 NA non-coding upstream 58890 1147007 ~ 1147555 (+)
G194991 NA non-coding upstream 116017 1090216 ~ 1090428 (+)
G194988 NA non-coding upstream 119649 1086531 ~ 1086796 (+)
G194987 NA non-coding upstream 120046 1086167 ~ 1086399 (+)
G195047 NA non-coding downstream 19157 1227485 ~ 1227867 (+)
G195048 NA non-coding downstream 20388 1228716 ~ 1228919 (+)
G195049 NA non-coding downstream 20900 1229228 ~ 1229433 (+)
G195535 NA non-coding downstream 176424 1384752 ~ 1384970 (+)
G195564 NA non-coding downstream 188435 1396763 ~ 1397086 (+)
G195003 NA other upstream 44755 1161157 ~ 1161690 (+)
G194721 NA other upstream 746100 458008 ~ 460345 (+)
CI01000046_01540075_01668012 HS3ST4 other downstream 331166 1539494 ~ 1668012 (+)
CI01000046_01865451_01881353 NA other downstream 664467 1865451 ~ 1881369 (+)
CI01000046_02451052_02454565 MAFK other downstream 1231589 2442395 ~ 2457280 (+)
G196936 NA other downstream 1978667 3186995 ~ 3194271 (+)
CI01000046_03943890_03945302 ATP5J2 other downstream 2735500 3943794 ~ 3945500 (+)

Expression


Co-expression Network