G195909


Basic Information

Item Value
gene id G195909
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 1743800 ~ 1744017 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU222506
CAAGAAGTTTGATCAATTAATACTATCGGTTAGACGGTTTAAAAAGAAAACAAACTATAAACATATAGCTATAGACAAGAAATCCTATAAACGGTAGCCTATTCAGAACAGAACCATAACGAAAAATAAAAGAACATGTCGCCTACCTCTCCAATTCGGCACAAATCCAAATGTTTCCATATTCGCGAAGTATTTGAATGCTAAATTATTATTTATTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU222506 True 218 lncRNA 0.31 1 1743800 1744017

Neighbor

gene id symbol gene type direction distance location
CI01000046_01540075_01668012 HS3ST4 coding upstream 75788 1539494 ~ 1668012 (+)
CI01000046_01318513_01343464 USP31 coding upstream 399605 1316670 ~ 1344195 (+)
CI01000046_01289846_01293954 KCTD5A, KCTD5 coding upstream 449464 1289568 ~ 1294336 (+)
CI01000046_01275798_01283718 PDPK1A coding upstream 459700 1275798 ~ 1284100 (+)
CI01000046_01255895_01262232 NA coding upstream 481253 1255895 ~ 1262547 (+)
CI01000046_01865451_01881353 NA coding downstream 121434 1865451 ~ 1881369 (+)
CI01000046_01903950_01922429 KDM8 coding downstream 158073 1902090 ~ 1922439 (+)
CI01000046_01933932_01935589 NA coding downstream 188873 1932890 ~ 1937822 (+)
CI01000046_01963803_01965901 NA coding downstream 219538 1963555 ~ 1968371 (+)
CI01000046_01988070_01995034 UBFD1 coding downstream 242303 1986320 ~ 1995330 (+)
G195564 NA non-coding upstream 346714 1396763 ~ 1397086 (+)
G195535 NA non-coding upstream 358830 1384752 ~ 1384970 (+)
G195049 NA non-coding upstream 514367 1229228 ~ 1229433 (+)
G195048 NA non-coding upstream 514881 1228716 ~ 1228919 (+)
G195047 NA non-coding upstream 515933 1227485 ~ 1227867 (+)
G196035 NA non-coding downstream 122487 1866504 ~ 1866807 (+)
G196038 NA non-coding downstream 126681 1870698 ~ 1870980 (+)
G196050 NA non-coding downstream 217202 1961219 ~ 1961759 (+)
G196051 NA non-coding downstream 218229 1962246 ~ 1962532 (+)
G195003 NA other upstream 582110 1161157 ~ 1161690 (+)
G194721 NA other upstream 1283455 458008 ~ 460345 (+)
CI01000046_02451052_02454565 MAFK other downstream 695900 2442395 ~ 2457280 (+)
G196936 NA other downstream 1442978 3186995 ~ 3194271 (+)
CI01000046_03943890_03945302 ATP5J2 other downstream 2199811 3943794 ~ 3945500 (+)
G197055 NA other downstream 2405406 4149423 ~ 4149780 (+)

Expression


Co-expression Network