G196051


Basic Information

Item Value
gene id G196051
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 1962246 ~ 1962532 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU222660
ATCTGAATGTTTATTGTACTGAAATCTTACTGATATGTCACTTGCATAATAATTTGGAACGCGGTGTAGTCATAAACACCTAGGATGGCTTGAGCGTGAGTAAATCATGGGATAATTTTCATTTTTGGGTAAACTATCCCTTTAAGTAAGGGGTAATCCACGGCTAGACATGCATTAAAGGATTTTAATGCACGACGTAGAGGCGAAGAACCACCCGACGCAAAGCGGTTTATACCTTGGTTATTTGCCAAGTTAAAGGAAAACTCCACTTTTTTTGAAAATAGGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU222660 True 287 lncRNA 0.38 1 1962246 1962532

Neighbor

gene id symbol gene type direction distance location
CI01000046_01933932_01935589 NA coding upstream 24424 1932890 ~ 1937822 (+)
CI01000046_01903950_01922429 KDM8 coding upstream 39807 1902090 ~ 1922439 (+)
CI01000046_01865451_01881353 NA coding upstream 80877 1865451 ~ 1881369 (+)
CI01000046_01540075_01668012 HS3ST4 coding upstream 294234 1539494 ~ 1668012 (+)
CI01000046_01318513_01343464 USP31 coding upstream 618051 1316670 ~ 1344195 (+)
CI01000046_01963803_01965901 NA coding downstream 1023 1963555 ~ 1968371 (+)
CI01000046_01988070_01995034 UBFD1 coding downstream 23788 1986320 ~ 1995330 (+)
CI01000046_02006028_02024639 NA coding downstream 43496 2006028 ~ 2024940 (+)
CI01000046_02027256_02031337 RMI2 coding downstream 64622 2027154 ~ 2031451 (+)
CI01000046_02037519_02037782 SNN, CP075, SNN.S, SNN.L coding downstream 74987 2037421 ~ 2039716 (+)
G196050 NA non-coding upstream 487 1961219 ~ 1961759 (+)
G196038 NA non-coding upstream 91266 1870698 ~ 1870980 (+)
G196035 NA non-coding upstream 95439 1866504 ~ 1866807 (+)
G195909 NA non-coding upstream 218229 1743800 ~ 1744017 (+)
G195978 NA non-coding downstream 34591 1997123 ~ 1999094 (+)
G195981 NA non-coding downstream 93538 2056070 ~ 2057016 (+)
G196076 NA non-coding downstream 115590 2078122 ~ 2078480 (+)
G195003 NA other upstream 800556 1161157 ~ 1161690 (+)
G194721 NA other upstream 1501901 458008 ~ 460345 (+)
CI01000046_02451052_02454565 MAFK other downstream 477385 2442395 ~ 2457280 (+)
G196936 NA other downstream 1224463 3186995 ~ 3194271 (+)
CI01000046_03943890_03945302 ATP5J2 other downstream 1981296 3943794 ~ 3945500 (+)
G197055 NA other downstream 2186891 4149423 ~ 4149780 (+)
G197121 NA other downstream 2408479 4371011 ~ 4371430 (+)

Expression


Co-expression Network