G196102


Basic Information

Item Value
gene id G196102
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 2163283 ~ 2163494 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU222718
TTGACTTAAGCATGTCATATAGAAGCCATAGTATGAGAAAAATGATTTGATTGGTTGCTGCTTCCATTGAAAAGGAACAAATGTGCATATTTTTAATGATTGGGCCTGTTCCCTAACATATGTTGAGGCAGTGGGTGCTCTTACGTTTCATGTTTTCTTCAGTACCTTGAGGATGCTAGTTGATTAAGGTCACTCTCCCGTATTGGACTTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU222718 True 212 lncRNA 0.39 1 2163283 2163494

Neighbor

gene id symbol gene type direction distance location
CI01000046_02123765_02158243 AXIN1 coding upstream 5040 2123765 ~ 2158243 (+)
CI01000046_02066859_02072868 NA coding upstream 90269 2066859 ~ 2073014 (+)
CI01000046_02037519_02037782 SNN, CP075, SNN.S, SNN.L coding upstream 124228 2037421 ~ 2039716 (+)
CI01000046_02027256_02031337 RMI2 coding upstream 131832 2027154 ~ 2031451 (+)
CI01000046_02006028_02024639 NA coding upstream 138343 2006028 ~ 2024940 (+)
CI01000046_02264732_02268319 UNCX coding downstream 101078 2264572 ~ 2268638 (+)
CI01000046_02335530_02348525 NA coding downstream 170480 2333974 ~ 2348945 (+)
CI01000046_02356713_02359204 NA coding downstream 193160 2356654 ~ 2360009 (+)
CI01000046_02365658_02365816 NA coding downstream 202164 2365658 ~ 2366186 (+)
CI01000046_02451052_02454565 MAFK coding downstream 287558 2442395 ~ 2457280 (+)
G195994 NA non-coding upstream 52520 2106352 ~ 2110763 (+)
G196087 NA non-coding upstream 74064 2088724 ~ 2089219 (+)
G196086 NA non-coding upstream 75769 2087279 ~ 2087514 (+)
G196085 NA non-coding upstream 76152 2086809 ~ 2087131 (+)
G196080 NA non-coding upstream 79637 2082685 ~ 2083646 (+)
G196106 NA non-coding downstream 2775 2166269 ~ 2166588 (+)
G196128 NA non-coding downstream 19004 2182498 ~ 2182699 (+)
G196131 NA non-coding downstream 32149 2195643 ~ 2195853 (+)
G196142 NA non-coding downstream 56701 2220195 ~ 2223088 (+)
G196141 NA non-coding downstream 61012 2224506 ~ 2226140 (+)
CI01000046_01865451_01881353 NA other upstream 204135 1865451 ~ 1881369 (+)
CI01000046_01540075_01668012 HS3ST4 other upstream 599946 1539494 ~ 1668012 (+)
G195003 NA other upstream 1001593 1161157 ~ 1161690 (+)
G194721 NA other upstream 1702938 458008 ~ 460345 (+)
G196936 NA other downstream 1023501 3186995 ~ 3194271 (+)
CI01000046_03943890_03945302 ATP5J2 other downstream 1780334 3943794 ~ 3945500 (+)
G197055 NA other downstream 1985929 4149423 ~ 4149780 (+)
G197121 NA other downstream 2207517 4371011 ~ 4371430 (+)

Expression


Co-expression Network