G196156


Basic Information

Item Value
gene id G196156
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 2263831 ~ 2264062 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU222785
CAACTCCAGACATTGGCCAAATAAAGTGGAATTAATTCTCTGTAATGAGAGGGGGAGACATGACGTGGGATTGATTACCATTCTGTATTCAAAAACACAGTTCACTTGCATAAATGCAATACATATATGTCACTGTTGACTTTAATATAAGATTAATTAATGATAATGATAGATTAAGGTGCACCCAACCACGTCCCGTCCTTAATTCAAAATATCAAATGATGATATAGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU222785 True 232 lncRNA 0.35 1 2263831 2264062

Neighbor

gene id symbol gene type direction distance location
CI01000046_02123765_02158243 AXIN1 coding upstream 105588 2123765 ~ 2158243 (+)
CI01000046_02066859_02072868 NA coding upstream 190817 2066859 ~ 2073014 (+)
CI01000046_02037519_02037782 SNN, CP075, SNN.S, SNN.L coding upstream 224776 2037421 ~ 2039716 (+)
CI01000046_02027256_02031337 RMI2 coding upstream 232380 2027154 ~ 2031451 (+)
CI01000046_02006028_02024639 NA coding upstream 238891 2006028 ~ 2024940 (+)
CI01000046_02264732_02268319 UNCX coding downstream 510 2264572 ~ 2268638 (+)
CI01000046_02335530_02348525 NA coding downstream 69912 2333974 ~ 2348945 (+)
CI01000046_02356713_02359204 NA coding downstream 92592 2356654 ~ 2360009 (+)
CI01000046_02365658_02365816 NA coding downstream 101596 2365658 ~ 2366186 (+)
CI01000046_02451052_02454565 MAFK coding downstream 186990 2442395 ~ 2457280 (+)
G196155 NA non-coding upstream 456 2263141 ~ 2263375 (+)
G196154 NA non-coding upstream 1349 2262248 ~ 2262482 (+)
G196147 NA non-coding upstream 8202 2255395 ~ 2255629 (+)
G196141 NA non-coding upstream 37691 2224506 ~ 2226140 (+)
G196142 NA non-coding upstream 40743 2220195 ~ 2223088 (+)
G196164 NA non-coding downstream 19476 2283538 ~ 2283766 (+)
G196176 NA non-coding downstream 37364 2301426 ~ 2301796 (+)
G196177 NA non-coding downstream 37793 2301855 ~ 2302078 (+)
G196119 NA non-coding downstream 45758 2309820 ~ 2649187 (+)
G196209 NA non-coding downstream 121688 2385750 ~ 2386244 (+)
CI01000046_01865451_01881353 NA other upstream 304683 1865451 ~ 1881369 (+)
CI01000046_01540075_01668012 HS3ST4 other upstream 700494 1539494 ~ 1668012 (+)
G195003 NA other upstream 1102141 1161157 ~ 1161690 (+)
G194721 NA other upstream 1803486 458008 ~ 460345 (+)
G196936 NA other downstream 922933 3186995 ~ 3194271 (+)
CI01000046_03943890_03945302 ATP5J2 other downstream 1679766 3943794 ~ 3945500 (+)
G197055 NA other downstream 1885361 4149423 ~ 4149780 (+)
G197121 NA other downstream 2106949 4371011 ~ 4371430 (+)

Expression


Co-expression Network