G196754


Basic Information

Item Value
gene id G196754
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 2981578 ~ 2981812 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU223413
AAACAGTTCCCTTGATGCAAACTGACTCGCTTTGATCTTAATACCCTCGATGCACCACAAGTACAAACATAGATACTCTGGGTAATGAGAGTGGTCTGTTCGGAGTGGTAAAACGGCATCATGTTGATAAAGGCACATCCGTCCTTCATCCGTTCCATATTTATTTTTTTCATCTCAGTCTTTTCCTTTCCGTCCAACCATTGGGCAGATTCTTTGAAGATGGAGGTTAAATTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU223413 True 235 lncRNA 0.41 1 2981578 2981812

Neighbor

gene id symbol gene type direction distance location
CI01000046_02933552_02949246 NA coding upstream 32260 2933487 ~ 2949318 (+)
CI01000046_02911888_02930362 NA coding upstream 50585 2911145 ~ 2930993 (+)
CI01000046_02868880_02871348 NUDT1, 8ODP coding upstream 109967 2868880 ~ 2871611 (+)
CI01000046_02794245_02796188 NA coding upstream 184490 2793879 ~ 2797088 (+)
CI01000046_02674254_02676647 ELFN1, ELFN1A coding upstream 304777 2674060 ~ 2676801 (+)
CI01000046_03041320_03042564 GRIFIN coding downstream 59508 3041320 ~ 3042750 (+)
CI01000046_03046400_03047689 NA coding downstream 63967 3045779 ~ 3048432 (+)
CI01000046_03138487_03139142 NA coding downstream 156675 3138487 ~ 3140879 (+)
CI01000046_03205894_03253907 NA coding downstream 223780 3205592 ~ 3254330 (+)
CI01000046_03347042_03438271 SDK1, SDK1A coding downstream 365230 3347042 ~ 3438271 (+)
G196749 NA non-coding upstream 15042 2966188 ~ 2966536 (+)
G196744 NA non-coding upstream 40089 2941148 ~ 2941489 (+)
G196698 NA non-coding upstream 108117 2794370 ~ 2873461 (+)
G196703 NA non-coding upstream 189366 2791961 ~ 2792212 (+)
G196691 NA non-coding upstream 205918 2775371 ~ 2775660 (+)
G196757 NA non-coding downstream 8352 2990164 ~ 2990436 (+)
G196773 NA non-coding downstream 34653 3016465 ~ 3016713 (+)
G196780 NA non-coding downstream 41347 3023159 ~ 3023393 (+)
G196809 NA non-coding downstream 61379 3043191 ~ 3043482 (+)
G196784 NA non-coding downstream 101121 3082933 ~ 3084120 (+)
CI01000046_02451052_02454565 MAFK other upstream 524298 2442395 ~ 2457280 (+)
CI01000046_01865451_01881353 NA other upstream 1022430 1865451 ~ 1881369 (+)
CI01000046_01540075_01668012 HS3ST4 other upstream 1418241 1539494 ~ 1668012 (+)
G195003 NA other upstream 1819888 1161157 ~ 1161690 (+)
G194721 NA other upstream 2521233 458008 ~ 460345 (+)
G196936 NA other downstream 205183 3186995 ~ 3194271 (+)
CI01000046_03943890_03945302 ATP5J2 other downstream 962016 3943794 ~ 3945500 (+)
G197055 NA other downstream 1167611 4149423 ~ 4149780 (+)
G197121 NA other downstream 1389199 4371011 ~ 4371430 (+)
G196869 NA other downstream 1433718 4415530 ~ 4421687 (+)

Expression


Co-expression Network