G196784


Basic Information

Item Value
gene id G196784
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 3082933 ~ 3084120 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU223443
CGGAAAGTGTGCTGCTTGTCCAGCTTGTAGCCATCAGCGTTTTTGACTGCTTCATGAGCATGACTTGGTGCAGAATACTCCAGGAAAATTTACCCCTTGGTCTTTCCATCTGCGTCTGGGTAGAATTCATTGGTGATTCTGCCAAACTTTGAGAAGATCTTGTGGATGACGTTCTTGAGTTTCTCCAGACGATCTGGTCCGACCTGATCACTGATGTCATCCACGAAATCCTCCGGATCACTGAACGAAGGCTCTTCTCCGTCCTCATACTCCATTTCGGCCTCCATATTCTCCGTATCTCGCATTTAGAGATCGATCGCTGTCAGTATGGGCTAGTGAAAAGGCGGTGGTAAATTTCACAGCAGTAATCCAGAGATTTTTCTCACTCGGCCATGTGCAAAGCAACCGGCGCCAACCACTGCGAGCGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU223443 True 429 lncRNA 0.49 3 3082933 3084120

Neighbor

gene id symbol gene type direction distance location
CI01000046_03046400_03047689 NA coding upstream 34501 3045779 ~ 3048432 (+)
CI01000046_03041320_03042564 GRIFIN coding upstream 40183 3041320 ~ 3042750 (+)
CI01000046_02981176_03006650 NA coding upstream 76258 2980827 ~ 3006675 (+)
CI01000046_02933552_02949246 NA coding upstream 133615 2933487 ~ 2949318 (+)
CI01000046_02911888_02930362 NA coding upstream 151940 2911145 ~ 2930993 (+)
CI01000046_03138487_03139142 NA coding downstream 54367 3138487 ~ 3140879 (+)
CI01000046_03205894_03253907 NA coding downstream 121472 3205592 ~ 3254330 (+)
CI01000046_03347042_03438271 SDK1, SDK1A coding downstream 262922 3347042 ~ 3438271 (+)
CI01000046_03443490_03508344 SDK1, SDK1A coding downstream 359157 3443277 ~ 3508481 (+)
CI01000046_03511698_03542614 SDK1, SDK1A coding downstream 427285 3511405 ~ 3542844 (+)
G196809 NA non-coding upstream 39451 3043191 ~ 3043482 (+)
G196780 NA non-coding upstream 59540 3023159 ~ 3023393 (+)
G196773 NA non-coding upstream 66220 3016465 ~ 3016713 (+)
G196757 NA non-coding upstream 92497 2990164 ~ 2990436 (+)
G196754 NA non-coding upstream 101121 2981578 ~ 2981812 (+)
G196975 NA non-coding downstream 478377 3562497 ~ 3563548 (+)
G196885 NA non-coding downstream 538592 3622712 ~ 3642563 (+)
G196857 NA non-coding downstream 554789 3638909 ~ 3641270 (+)
CI01000046_02451052_02454565 MAFK other upstream 625653 2442395 ~ 2457280 (+)
CI01000046_01865451_01881353 NA other upstream 1123785 1865451 ~ 1881369 (+)
CI01000046_01540075_01668012 HS3ST4 other upstream 1519596 1539494 ~ 1668012 (+)
G195003 NA other upstream 1921243 1161157 ~ 1161690 (+)
G194721 NA other upstream 2622588 458008 ~ 460345 (+)
G196936 NA other downstream 102875 3186995 ~ 3194271 (+)
CI01000046_03943890_03945302 ATP5J2 other downstream 859708 3943794 ~ 3945500 (+)
G197055 NA other downstream 1065303 4149423 ~ 4149780 (+)
G197121 NA other downstream 1286891 4371011 ~ 4371430 (+)
G196869 NA other downstream 1331410 4415530 ~ 4421687 (+)

Expression


Co-expression Network