G196867


Basic Information

Item Value
gene id G196867
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 4126877 ~ 4127188 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU223528
CACGGAGAGCTGCGTATCGATGGTTACGGATCCGTTTCCGGTCTGCTGTGCCAGATGCCCGTCTCTGAATCTCCTTGCAGTAATACTGCGCCCTGCAGTCACTGCTCAGGTGTGAGAAAGCGTCCATGTGCTCTGGCTTCAGATGGGCCTGATAGCGCTCTAGAAAAACCAAGGGCTTGGATTTGTACTGATCCATTAAAACCTTCTTCTTCTCCTCCAGAGTTAAGTCTGGCTCCCCCAGCTGCTGGCTTTTCACTGGACTCCCACTGGCTGCTACAGCCTCGATCATTGCGCTGAGACAGCTGGATGGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU223528 True 312 lncRNA 0.54 1 4126877 4127188

Neighbor

gene id symbol gene type direction distance location
CI01000046_04098044_04120141 LLGL1 coding upstream 6525 4096231 ~ 4120352 (+)
CI01000046_04081845_04083512 NA coding upstream 43342 4081721 ~ 4083535 (+)
CI01000046_04040958_04080846 NA coding upstream 45558 4040023 ~ 4081319 (+)
CI01000046_04024795_04028000 DRG2 coding upstream 98877 4024551 ~ 4028000 (+)
CI01000046_03998572_04009276 ZNF598 coding upstream 116661 3998572 ~ 4010216 (+)
CI01000046_04274035_04275654 B9D1 coding downstream 146664 4273852 ~ 4275762 (+)
CI01000046_04308380_04317709 GRAP, GRAPA coding downstream 181192 4308380 ~ 4317970 (+)
CI01000046_04319601_04326459 NA coding downstream 192413 4319601 ~ 4326532 (+)
CI01000046_04478947_04510165 ARHGAP23A coding downstream 351759 4478947 ~ 4511125 (+)
CI01000046_04532653_04542785 PLCD3, PLCD3A coding downstream 405465 4532653 ~ 4542785 (+)
G196871 NA non-coding upstream 433 4125998 ~ 4126444 (+)
G197039 NA non-coding upstream 176049 3950585 ~ 3950828 (+)
G197024 NA non-coding upstream 212040 3914584 ~ 3914837 (+)
G196887 NA non-coding upstream 235036 3891020 ~ 3891841 (+)
G196994 NA non-coding upstream 354799 3771842 ~ 3772078 (+)
G197051 NA non-coding downstream 425 4127613 ~ 4128009 (+)
G196870 NA non-coding downstream 1317 4128505 ~ 4128795 (+)
G197052 NA non-coding downstream 7100 4134288 ~ 4137233 (+)
G197053 NA non-coding downstream 11458 4138646 ~ 4139099 (+)
G197054 NA non-coding downstream 15228 4142416 ~ 4143977 (+)
CI01000046_03943890_03945302 ATP5J2 other upstream 181377 3943794 ~ 3945500 (+)
G196936 NA other upstream 932606 3186995 ~ 3194271 (+)
CI01000046_02451052_02454565 MAFK other upstream 1669597 2442395 ~ 2457280 (+)
CI01000046_01865451_01881353 NA other upstream 2167729 1865451 ~ 1881369 (+)
CI01000046_01540075_01668012 HS3ST4 other upstream 2563540 1539494 ~ 1668012 (+)
G197055 NA other downstream 22235 4149423 ~ 4149780 (+)
G197121 NA other downstream 243823 4371011 ~ 4371430 (+)
G196869 NA other downstream 288342 4415530 ~ 4421687 (+)
G197352 NA other downstream 1147194 5259318 ~ 5276453 (+)
G197528 NA other downstream 1598933 5726121 ~ 5742684 (+)

Expression


Co-expression Network