G197056


Basic Information

Item Value
gene id G197056
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 4151723 ~ 4151967 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU223721
CTTTAAGGGGAGATCACATTGCATATTAGCTACATATTTAGCTGTAAATTTAAATTGAGTTAACATATACTGTATTTTAGATTCAATTTCTATACAATATTTAATTTATATTTTGTATATATGTATAATTTTTATATTTGTATATATAATTTTGTGCACATGCTTAAGAAAGACAAACATAATACTGTAACTGAGCCAGTTGTAATAGAATGGTTTTTTTATACCTCTGCCTGAAACCCCTCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU223721 True 245 lncRNA 0.26 1 4151723 4151967

Neighbor

gene id symbol gene type direction distance location
CI01000046_04098044_04120141 LLGL1 coding upstream 31371 4096231 ~ 4120352 (+)
CI01000046_04081845_04083512 NA coding upstream 68188 4081721 ~ 4083535 (+)
CI01000046_04040958_04080846 NA coding upstream 70404 4040023 ~ 4081319 (+)
CI01000046_04024795_04028000 DRG2 coding upstream 123723 4024551 ~ 4028000 (+)
CI01000046_03998572_04009276 ZNF598 coding upstream 141507 3998572 ~ 4010216 (+)
CI01000046_04274035_04275654 B9D1 coding downstream 121885 4273852 ~ 4275762 (+)
CI01000046_04308380_04317709 GRAP, GRAPA coding downstream 156413 4308380 ~ 4317970 (+)
CI01000046_04319601_04326459 NA coding downstream 167634 4319601 ~ 4326532 (+)
CI01000046_04478947_04510165 ARHGAP23A coding downstream 326980 4478947 ~ 4511125 (+)
CI01000046_04532653_04542785 PLCD3, PLCD3A coding downstream 380686 4532653 ~ 4542785 (+)
G197054 NA non-coding upstream 7746 4142416 ~ 4143977 (+)
G197053 NA non-coding upstream 12624 4138646 ~ 4139099 (+)
G197052 NA non-coding upstream 14490 4134288 ~ 4137233 (+)
G196870 NA non-coding upstream 22928 4128505 ~ 4128795 (+)
G197051 NA non-coding upstream 23714 4127613 ~ 4128009 (+)
G197060 NA non-coding downstream 9342 4161309 ~ 4161513 (+)
G197061 NA non-coding downstream 10620 4162587 ~ 4162788 (+)
G197058 NA non-coding downstream 14156 4166123 ~ 4166464 (+)
G197062 NA non-coding downstream 16149 4168116 ~ 4168421 (+)
G197057 NA non-coding downstream 16982 4168949 ~ 4169652 (+)
G197055 NA other upstream 1943 4149423 ~ 4149780 (+)
CI01000046_03943890_03945302 ATP5J2 other upstream 206223 3943794 ~ 3945500 (+)
G196936 NA other upstream 957452 3186995 ~ 3194271 (+)
CI01000046_02451052_02454565 MAFK other upstream 1694443 2442395 ~ 2457280 (+)
CI01000046_01865451_01881353 NA other upstream 2192575 1865451 ~ 1881369 (+)
G197121 NA other downstream 219044 4371011 ~ 4371430 (+)
G196869 NA other downstream 263563 4415530 ~ 4421687 (+)
G197352 NA other downstream 1122415 5259318 ~ 5276453 (+)
G197528 NA other downstream 1574154 5726121 ~ 5742684 (+)
CI01000046_06808895_06820945 GSPT1, ERF3B, GSPT1L other downstream 2667971 6808507 ~ 6821543 (+)

Expression


Co-expression Network