G197135


Basic Information

Item Value
gene id G197135
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 4412862 ~ 4413349 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU223805
TCTGTCGTGAATATGGCTCCCACGGCTCATCCTCCGGACCGCCGGAGGGAGCCATCTCCGGAATATTGACTCTTTGCCATTCGGACTCCATTTCCCATAGGCCCTCATTCCTGGGACTGATTGCACTTTCACCTGCACCACATCACACACACACTATTTAAGACACGCACGCACACCACATCTTTGCGAAGTCTTGATTTGCTACGGTAGTCATTTCTGAGCATTATTTCTGTGGACTGATATCTTGTTATTACCCGGATTGTTTGTTATCTGTGAACCTCTGCCGCCTGCCCTGAACTTTGCTTGTACCCTGGACTGTGATTGTTTGCCGCCTGTCTTGATCTCTGCCTGTGACCCGTCTCTGATTCCTGCTGCCAGCCTCGACCCCTGCCTGTCCCTGACTACGGTATTGCTCTGCCCTTTCCTGTACTGCTGCTGTGTTTAATAAAGCTGCTTATGGATCCACACACTGTTGACCCATCATTACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU223805 True 488 lncRNA 0.50 1 4412862 4413349

Neighbor

gene id symbol gene type direction distance location
CI01000046_04319601_04326459 NA coding upstream 86330 4319601 ~ 4326532 (+)
CI01000046_04308380_04317709 GRAP, GRAPA coding upstream 94892 4308380 ~ 4317970 (+)
CI01000046_04274035_04275654 B9D1 coding upstream 137100 4273852 ~ 4275762 (+)
CI01000046_04098044_04120141 LLGL1 coding upstream 292510 4096231 ~ 4120352 (+)
CI01000046_04081845_04083512 NA coding upstream 329327 4081721 ~ 4083535 (+)
CI01000046_04478947_04510165 ARHGAP23A coding downstream 65598 4478947 ~ 4511125 (+)
CI01000046_04532653_04542785 PLCD3, PLCD3A coding downstream 119304 4532653 ~ 4542785 (+)
CI01000046_04545960_04557955 NMT1A, NMT1 coding downstream 132611 4545960 ~ 4558453 (+)
CI01000046_04563154_04565515 NA coding downstream 149738 4563087 ~ 4565727 (+)
CI01000046_04579543_04581492 NA coding downstream 165932 4579281 ~ 4581540 (+)
G197130 NA non-coding upstream 15032 4397518 ~ 4397830 (+)
G197125 NA non-coding upstream 30370 4382278 ~ 4382492 (+)
G197124 NA non-coding upstream 33074 4374282 ~ 4379788 (+)
G197119 NA non-coding upstream 43660 4368956 ~ 4369202 (+)
G197115 NA non-coding upstream 52362 4360222 ~ 4360500 (+)
G197136 NA non-coding downstream 8387 4421736 ~ 4421959 (+)
G197140 NA non-coding downstream 22529 4435878 ~ 4436252 (+)
G196889 NA non-coding downstream 23888 4437237 ~ 4443882 (+)
G197153 NA non-coding downstream 227832 4641181 ~ 4643913 (+)
G197158 NA non-coding downstream 235601 4648950 ~ 4708769 (+)
G197121 NA other upstream 41432 4371011 ~ 4371430 (+)
G197055 NA other upstream 263082 4149423 ~ 4149780 (+)
CI01000046_03943890_03945302 ATP5J2 other upstream 467362 3943794 ~ 3945500 (+)
G196936 NA other upstream 1218591 3186995 ~ 3194271 (+)
CI01000046_02451052_02454565 MAFK other upstream 1955582 2442395 ~ 2457280 (+)
G196869 NA other downstream 2181 4415530 ~ 4421687 (+)
G197352 NA other downstream 861033 5259318 ~ 5276453 (+)
G197528 NA other downstream 1312772 5726121 ~ 5742684 (+)
CI01000046_06808895_06820945 GSPT1, ERF3B, GSPT1L other downstream 2406589 6808507 ~ 6821543 (+)

Expression


Co-expression Network