CI01000047_03713156_03716003


Basic Information

Item Value
gene id CI01000047_03713156_03716003
gene name NA
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 3713156 ~ 3716003 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000047_03713156_03716003.mRNA
ATGACTTCCTGGTGGACACGGATGGGAGGATGCCAGGAAGAGGAGGACATGTGGAAAGAGATGAAGGAGAAGAGTCTCAACTGAGGCTGCAGTTGAAGAGGAAACTTCAGCGCAACAGAACCAGCTTCACAACAGAGCAGATTGAGGCCTTGGAGAAAGAGTTTGAGAGAACACATTATCCGGATGTTTTCGCACGAGAGCGACTTGCAAACAAAATCGACCTTCCAGAGGCACGAATACAGGTGTGGTTTTCCAATCGAAGAGCTAAATGGAGGCGTGAGGAGAAGCTGCGAAACCAGAGGCGGTCTGGAGGCGGGACTTCCTGTGCACAAACACACGCTCCACTGAACACATCCTTTAATTCAGCTGTTTATCATCATCCTCACGGCAACAGTGCAGCATCCATGATCAGTCAGAGTGACACAGCTTTGCCCAGTTATAACTCTCTCTCAGTCTATACTGGGGTCCAGTCTGCTCCTTCTCCATCTGCCTCCTCGTACTCCTGCATGCTGCCTCCGTCCCCATCTGCACCTCGCTCGTTTGAGACATCATACTCCTCTTCTCATCTTCCAGCTCCTTCTTCAACTAACACCAGCACAG

Function

NR:

description
Similar to Pax-family transcription factor 6.2

GO: NA

KEGG:

id description
K08031 PAX6; paired box protein 6

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000047_03713156_03716003.mRNA True 600 mRNA 0.51 5 3713156 3716003

Neighbor

gene id symbol gene type direction distance location
CI01000047_03689400_03699969 NA coding downstream 13187 3689400 ~ 3699969 (-)
CI01000047_03514753_03523245 NA coding downstream 189911 3514451 ~ 3523245 (-)
CI01000047_03412414_03435209 KANSL1A coding downstream 276973 3412398 ~ 3436183 (-)
CI01000047_03321589_03328761 GHRHR2 coding downstream 384395 3319692 ~ 3328761 (-)
CI01000047_03271413_03302291 SCN4AA coding downstream 410785 3269915 ~ 3302371 (-)
CI01000047_03741720_03750331 MAPK7 coding upstream 25067 3741070 ~ 3750375 (-)
CI01000047_03785018_03800982 NA coding upstream 68739 3784742 ~ 3801004 (-)
CI01000047_03855710_03868781 NA coding upstream 139540 3855543 ~ 3869804 (-)
CI01000047_03873674_03934985 NA coding upstream 157456 3873459 ~ 3935129 (-)
CI01000047_03947036_03979744 NA coding upstream 230303 3946306 ~ 3980325 (-)
G202949 NA non-coding downstream 24594 3687526 ~ 3688562 (-)
G202942 NA non-coding downstream 25853 3685788 ~ 3687303 (-)
G202932 NA non-coding downstream 37506 3675391 ~ 3675650 (-)
G202931 NA non-coding downstream 38514 3671376 ~ 3674642 (-)
G202900 NA non-coding downstream 87287 3617469 ~ 3625869 (-)
G203012 NA non-coding upstream 4114 3720117 ~ 3720493 (-)
G203010 NA non-coding upstream 4699 3720702 ~ 3721356 (-)
G202952 NA non-coding upstream 13959 3729962 ~ 3739740 (-)
G202938 NA non-coding upstream 36109 3752112 ~ 3752831 (-)
G202946 NA non-coding upstream 38784 3754787 ~ 3755783 (-)
G202733 NA other downstream 579504 3132313 ~ 3133652 (-)
CI01000047_01708628_01744282 BICC1B, BICC1 other downstream 1997639 1706068 ~ 1744282 (-)
G200472 NA other downstream 2878685 833941 ~ 834471 (-)
CI01000047_00519408_00522108 PYYB other downstream 3190914 519108 ~ 522245 (-)
G200299 NA other downstream 3445121 267530 ~ 268035 (-)
G202944 NA other upstream 81800 3985342 ~ 3986402 (-)
CI01000047_04213574_04213976 NA other upstream 497406 4213409 ~ 4214085 (-)
CI01000047_04285605_04286644 COA3A other upstream 562905 4285227 ~ 4286694 (-)
CI01000047_04575184_04576337 GNGT2B, GNGT2 other upstream 858332 4574335 ~ 4576342 (-)
G203286 NA other upstream 1158376 4874379 ~ 4876734 (-)

Expression


Co-expression Network