CI01000047_04575184_04576337 (GNGT2B, GNGT2)


Basic Information

Item Value
gene id CI01000047_04575184_04576337
gene name GNGT2B, GNGT2
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 4574335 ~ 4576342 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000047_04575184_04576337.mRNA
ATGGCTCGGGACATGTCAGATAAAGAGATCCTGAAGATGGAGCTGGACCAGCTGAAGTTGGAAGTGAACACTCCCCGAATTGCGATTTCAAAAACAGCCCCAGAAATCATTGCTTTCGTTGAGGAGAAGTCTGGCGAAGACCCCCTGGTCAAGGGCGTCCCGGAGGACAAGAACCCATTCAAGGAGAAGGGAGGCTGCATTATCACGTAGCAACGGCCCTGGGGGAACCAGGGCTCTGTTCAATATCTACTTTTGTATAAAGGTTATTTGTACTAGAAACTCTGAATCATTTAGCATCCACTGTAGTTTTGATCATTATTCAGCTCCAGAAGTTTAAGAGGACACCATCATGTCATTCAATATCTTTTGTGATATGATATTTTCTGTCTGCTTTTAAAATAAA

Function

symbol description
gngt2b Predicted to enable G-protein beta-subunit binding activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to act upstream of or within signal transduction. Predicted to be located in plasma membrane. Predicted to be part of heterotrimeric G-protein complex. Is expressed in pineal complex; retina; and retinal cone cell. Orthologous to human GNGT2 (G protein subunit gamma transducin 2).
gngt2 Enables GTPase activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Part of heterotrimeric G-protein complex.

NR:

description
cone transducin gamma subunit, partial

GO:

id name namespace
GO:0005834 heterotrimeric G-protein complex cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000047_04575184_04576337.mRNA False 403 mRNA 0.44 2 4574991 4576337

Neighbor

gene id symbol gene type direction distance location
CI01000047_04555399_04568166 NA coding downstream 6671 4554822 ~ 4568320 (-)
CI01000047_04479638_04501854 NA coding downstream 73018 4479241 ~ 4501973 (-)
CI01000047_04458864_04461672 NA coding downstream 112897 4458771 ~ 4462094 (-)
CI01000047_04398951_04431817 NA coding downstream 143174 4398951 ~ 4431817 (-)
CI01000047_04385029_04397861 NA coding downstream 177130 4384547 ~ 4397861 (-)
CI01000047_04589853_04594533 NA coding upstream 13433 4589770 ~ 4594636 (-)
CI01000047_04596548_04605172 LSM12A, LSM12, LSM12B coding upstream 19643 4595980 ~ 4605172 (-)
CI01000047_04613815_04652751 TANC2 coding upstream 37478 4613815 ~ 4652751 (-)
CI01000047_04703391_04706693 NA coding upstream 126701 4703038 ~ 4706693 (-)
CI01000047_04790377_04795864 CNTD1 coding upstream 213887 4790224 ~ 4796316 (-)
G203221 NA non-coding downstream 24734 4550020 ~ 4550257 (-)
G203219 NA non-coding downstream 28775 4545569 ~ 4546216 (-)
G203217 NA non-coding downstream 38421 4536341 ~ 4536570 (-)
G203204 NA non-coding downstream 72469 4502205 ~ 4502522 (-)
G203191 NA non-coding downstream 149632 4420159 ~ 4425359 (-)
G203258 NA non-coding upstream 225560 4801897 ~ 4802226 (-)
G203298 NA non-coding upstream 306316 4882653 ~ 4882903 (-)
G203323 NA non-coding upstream 359169 4935506 ~ 4948267 (-)
G203303 NA non-coding upstream 397959 4974296 ~ 4978735 (-)
G203355 NA non-coding upstream 412820 4989157 ~ 4989456 (-)
CI01000047_04285605_04286644 COA3A other downstream 288310 4285227 ~ 4286694 (-)
CI01000047_04213574_04213976 NA other downstream 360561 4213409 ~ 4214085 (-)
G202944 NA other downstream 588589 3985342 ~ 3986402 (-)
G202733 NA other downstream 1441339 3132313 ~ 3133652 (-)
CI01000047_01708628_01744282 BICC1B, BICC1 other downstream 2859474 1706068 ~ 1744282 (-)
G203286 NA other upstream 298042 4874379 ~ 4876734 (-)
G203840 NA other upstream 1342171 5918508 ~ 5927344 (-)
G203881 NA other upstream 1466916 6043253 ~ 6043789 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
eurasian perch (Perca fluviatilis) G80603 NA non-coding NC_053118.1 CM020915.1 41610981 ~ 41611190 (-)
striped catfish (Pangasianodon hypophthalmus) G91248 NA non-coding NC_047599.1 CM018545.1 31239228 ~ 31240310 (+)
bowfin (Amia calva) G86695 LOC103362787 non-coding CM030130.1 CM030130.1 20699214 ~ 20702457 (+)