CI01000047_06968741_06972782 (ERD2, KDELR2.L, ERD22, KDELR2, KDELR1, KDELR2A, KDELR2B)


Basic Information

Item Value
gene id CI01000047_06968741_06972782
gene name ERD2, KDELR2.L, ERD22, KDELR2, KDELR1, KDELR2A, KDELR2B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 6968324 ~ 6972850 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000047_06968741_06972782.mRNA
ACTCGAAGCGTCGCACAGCCGGTTCCCCGCACACATTTGAACAACACATTCACCCGATCCAAAGAAACATGAACATCTTCAGACTGACGGGGGATCTGTCCCATTTAGCAGCCATCATCATCCTACTGATGAAGATATGGAAGACCAGGTCGTGTGCAGGGATATCTGGGAAGAGTCAGATTCTGTTTGCGCTGGTGTTCACCACACGCTACCTGGACCTTCTCACCGCCTTCATCTCCTTCTACAACTCCATCATGAAGGTCATCTATATCGCCTGTGCCTATGCCACGGTTTACCTGATATATGCCAAATTCAAGGCCACATATGACGGCAACCACGACACTTTCAGGGTGGAGTTCCTGGTGGTGCCTGTCGGCGGCCTGGCGTTCCTCGTCAACCATGACTTCTCTCCTCTGGAGATCCTGTGGACTTTTTCCATCTATCTGGAGTCAGTGGCCATCCTTCCACAGCTGTTCATGATCAGCAAGACCGGAGAAGCTGAGACCATCACCACACACTACCTGTTCTTCCTCGGCCTGTATCGCGCCCTGTATCTCATCAACTGGATCTGGCGCTTCTACTTCGAAGGCTTCTTCGACATGATCGCCATCGTCGCCGGCATCGTTCAGACAATCCTCTACTGTGACTTCTTTTATCTATACGTAACAAAAGTGTTGAAAGGAAAGAAGCTGAGTCTCCCAGCTTAAGGGCCGAAGACAGGAGCCCTGGCAGCGCGTGGAGGGCCGCGGGACGCAGAGGACGAGAAAGATGCCTGAGACGGAGTGCGAAAGACATCCGTTCCTGGTCACATCAGGTGCTCTGGATTCAAGCCCAGGCCGTACCATGGCTTTTCGGATTCCTGTTTTATGCATCTTGTCTTACCCTTTTTTATTATTCTGTATAAAAGTTTTCTACATGAAACGTGTACTATGATTTGACCGACGGAATCACAAACGAGCTGAAATTGCCTCATCGGGCAATGCTAACAGGCAGGGACTGATTCTTATGATGAATATTGATTTTGTTTGTAAGCGTATTTTCAATCTGATTATTAAATGTACATGTTTTCAAGAAGATTAAGGGAGTATTTGTTGCTCCGTAAGGATAAAATTGAATGGAATAAA

Function

symbol description
kdelr2b Predicted to enable ER retention sequence binding activity. Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport and protein retention in ER lumen. Predicted to act upstream of or within protein transport. Predicted to be located in COPI-coated vesicle membrane; Golgi membrane; and endoplasmic reticulum membrane. Predicted to be integral component of membrane. Predicted to be active in cis-Golgi network and endoplasmic reticulum. Is expressed in ectoderm; epidermis; notochord; otic vesicle; and splanchnocranium. Human ortholog(s) of this gene implicated in osteogenesis imperfecta type 21. Orthologous to several human genes including KDELR2 (KDEL endoplasmic reticulum protein retention receptor 2).
kdelr2a Predicted to enable KDEL sequence binding activity. Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport; protein retention in ER lumen; and retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum. Predicted to act upstream of or within protein transport and vesicle-mediated transport. Predicted to be located in Golgi membrane and endoplasmic reticulum membrane. Predicted to be integral component of membrane. Predicted to be active in cis-Golgi network and endoplasmic reticulum. Predicted to colocalize with COPI-coated vesicle membrane. Is expressed in several structures, including axis; digestive system; ectoderm; fin; and polster. Human ortholog(s) of this gene implicated in osteogenesis imperfecta type 21. Orthologous to several human genes including KDELR2 (KDEL endoplasmic reticulum protein retention receptor 2).
kdelr1 Enables KDEL sequence binding activity. Involved in retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum. Located in Golgi membrane; endoplasmic reticulum membrane; and endoplasmic reticulum-Golgi intermediate compartment. Colocalizes with COPI-coated vesicle membrane.
kdelr2 Enables KDEL sequence binding activity. Involved in retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum. Located in Golgi membrane and endoplasmic reticulum membrane. Colocalizes with COPI-coated vesicle membrane. Implicated in osteogenesis imperfecta type 21.
erd2 Enables HDEL sequence binding activity. Involved in endoplasmic reticulum to Golgi vesicle-mediated transport. Is integral component of endoplasmic reticulum membrane. Human ortholog(s) of this gene implicated in osteogenesis imperfecta type 21. Orthologous to several human genes including KDELR1 (KDEL endoplasmic reticulum protein retention receptor 1) and KDELR2 (KDEL endoplasmic reticulum protein retention receptor 2).

GO:

id name namespace
GO:0005794 Golgi apparatus cellular_component

KEGG:

id description
K10949 KDELR; ER lumen protein retaining receptor

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000047_06968741_06972782.mRNA True 1124 mRNA 0.48 5 6968324 6972850

Neighbor

gene id symbol gene type direction distance location
CI01000047_06958499_06967108 DAGLB coding downstream 490 6957983 ~ 6967834 (-)
CI01000047_06900704_06954882 SPAG9 coding downstream 13442 6900704 ~ 6954882 (-)
CI01000047_06843638_06844618 TOB1A, TOB1, TOB1B coding downstream 123706 6843370 ~ 6844618 (-)
CI01000047_06667661_06692521 NA coding downstream 275803 6667220 ~ 6692521 (-)
CI01000047_06660338_06666635 SULT2ST1, SULT2ST2 coding downstream 301689 6660300 ~ 6666635 (-)
CI01000047_06978552_06982232 METTL9 coding upstream 5598 6978448 ~ 6982542 (-)
CI01000047_06993737_07007548 POLR3E coding upstream 20872 6993722 ~ 7007548 (-)
CI01000047_07010651_07017023 NA coding upstream 37679 7010529 ~ 7017023 (-)
CI01000047_07072890_07079236 GAS7B, GAS7 coding upstream 99695 7072545 ~ 7079236 (-)
CI01000047_07137958_07149332 NA coding upstream 164534 7137384 ~ 7149332 (-)
G203947 NA non-coding downstream 70172 6896001 ~ 6898152 (-)
G204129 NA non-coding downstream 75144 6892834 ~ 6893180 (-)
G204098 NA non-coding downstream 115521 6852603 ~ 6852803 (-)
G204097 NA non-coding downstream 116486 6851639 ~ 6851838 (-)
G204095 NA non-coding downstream 118192 6849702 ~ 6850132 (-)
G204139 NA non-coding upstream 45273 7018123 ~ 7018330 (-)
G204149 NA non-coding upstream 90356 7063206 ~ 7063431 (-)
G203935 NA non-coding upstream 147603 7120453 ~ 7128069 (-)
G204167 NA non-coding upstream 311689 7284539 ~ 7285427 (-)
G204175 NA non-coding upstream 323690 7296540 ~ 7296838 (-)
G203881 NA other downstream 924535 6043253 ~ 6043789 (-)
G203840 NA other downstream 1040980 5918508 ~ 5927344 (-)
G203286 NA other downstream 2091590 4874379 ~ 4876734 (-)
CI01000047_04575184_04576337 GNGT2B, GNGT2 other downstream 2391359 4574335 ~ 4576342 (-)
CI01000047_04285605_04286644 COA3A other downstream 2681643 4285227 ~ 4286694 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_005054 kdelr2b coding NC_007123.7 CM002896.2 982796 ~ 990149 (-)
bowfin (Amia calva) AMCG00018404 kdelr2,LOC103354828,LOC102232388,LOC100710456,LOC107091462,LOC104935524 coding CM030135.1 CM030135.1 9973285 ~ 9980996 (-)