G200262


Basic Information

Item Value
gene id G200262
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 156207 ~ 257270 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU227262
CCAAAAAAACAAAATAACGACTTTTCAACAATATATAGTCATGGGCCGATTTCAAAACACTGCTTCATGAAGCTTCTGAGCTTTATGAATCTTTTGTTTCAAATTAGTGATTCGGATCTCCTATCAAATGGCTAAACTGCTGAAATCATGTGATTTTGGTGCTCCGATTCACTGATTCGATTCGTAAAGCTCCGAAGCAGTGTTTTGAAATCGCCCATATAGATATTGTTAAAAAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU227262 True 237 lncRNA 0.35 2 156207 257270

Neighbor

gene id symbol gene type direction distance location
CI01000047_00124354_00130228 DNAJC9 coding downstream 25821 124003 ~ 130386 (-)
CI01000047_00103238_00106878 NA coding downstream 49179 102352 ~ 107028 (-)
CI01000047_00099711_00100984 NA coding downstream 55223 99652 ~ 100984 (-)
CI01000047_00082013_00099032 NA coding downstream 57001 81600 ~ 99206 (-)
CI01000047_00010948_00034205 PPP1R9BB coding downstream 121711 10633 ~ 34496 (-)
CI01000047_00347663_00378777 NGFRB coding upstream 89463 346733 ~ 378777 (-)
CI01000047_00468782_00483200 MPP2B, MPP2 coding upstream 211138 468408 ~ 483200 (-)
CI01000047_00519408_00522108 PYYB coding upstream 262019 519108 ~ 522245 (-)
CI01000047_00532901_00545479 NDC80 coding upstream 274284 531554 ~ 545479 (-)
CI01000047_00546330_00551551 NA coding upstream 288686 545956 ~ 551551 (-)
G200216 NA non-coding downstream 35060 78005 ~ 121147 (-)
G200247 NA non-coding downstream 84099 71907 ~ 72108 (-)
G200293 NA non-coding upstream 2696 259966 ~ 260170 (-)
G200298 NA non-coding upstream 9910 267180 ~ 267426 (-)
G200309 NA non-coding upstream 29688 286958 ~ 287477 (-)
G200310 NA non-coding upstream 30436 287706 ~ 288141 (-)
G200311 NA non-coding upstream 31616 288886 ~ 289110 (-)
G200299 NA other upstream 10260 267530 ~ 268035 (-)
G200472 NA other upstream 576671 833941 ~ 834471 (-)
CI01000047_01708628_01744282 BICC1B, BICC1 other upstream 1448798 1706068 ~ 1744282 (-)
G202733 NA other upstream 2875043 3132313 ~ 3133652 (-)

Expression


Co-expression Network