G200316


Basic Information

Item Value
gene id G200316
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 313180 ~ 313432 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU227319
TTTTGTTTGAGAAGCCATTTCAGATATCCATCACAATAGGGAACTGACTATTTCTCTTGTCGTGCAACAAAGGTCATGCAAATCCATCAGCTAGTTAGTAAGAATTTTTTGGGGCTATCCTTTTGGGAAATATCCTTTTAACACATTTCCTCATTTTTAGTGCTTAGCTTGAAGGTTGACATTTGCAACAAAATATTTGTTATTGAAATATTTGCACCATCTGCAATGAACCCTCTACATAAACATATCATTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU227319 True 253 lncRNA 0.34 1 313180 313432

Neighbor

gene id symbol gene type direction distance location
CI01000047_00235688_00240415 TACO1 coding downstream 72411 235516 ~ 240769 (-)
CI01000047_00209567_00227765 NA coding downstream 85415 209497 ~ 227765 (-)
CI01000047_00160239_00163260 NA coding downstream 149900 158824 ~ 163280 (-)
CI01000047_00124354_00130228 DNAJC9 coding downstream 182794 124003 ~ 130386 (-)
CI01000047_00103238_00106878 NA coding downstream 206152 102352 ~ 107028 (-)
CI01000047_00347663_00378777 NGFRB coding upstream 33301 346733 ~ 378777 (-)
CI01000047_00468782_00483200 MPP2B, MPP2 coding upstream 154976 468408 ~ 483200 (-)
CI01000047_00519408_00522108 PYYB coding upstream 205857 519108 ~ 522245 (-)
CI01000047_00532901_00545479 NDC80 coding upstream 218122 531554 ~ 545479 (-)
CI01000047_00546330_00551551 NA coding upstream 232524 545956 ~ 551551 (-)
G200305 NA non-coding downstream 4001 307234 ~ 309179 (-)
G200307 NA non-coding downstream 6396 305214 ~ 306784 (-)
G200311 NA non-coding downstream 24070 288886 ~ 289110 (-)
G200310 NA non-coding downstream 25039 287706 ~ 288141 (-)
G200309 NA non-coding downstream 25703 286958 ~ 287477 (-)
G200325 NA non-coding upstream 15974 329406 ~ 329618 (-)
G200329 NA non-coding upstream 24495 337927 ~ 338267 (-)
G200332 NA non-coding upstream 27722 341154 ~ 341480 (-)
G200372 NA non-coding upstream 145488 458920 ~ 459172 (-)
G200376 NA non-coding upstream 147998 461430 ~ 463091 (-)
G200299 NA other downstream 45145 267530 ~ 268035 (-)
G200472 NA other upstream 520509 833941 ~ 834471 (-)
CI01000047_01708628_01744282 BICC1B, BICC1 other upstream 1392636 1706068 ~ 1744282 (-)
G202733 NA other upstream 2818881 3132313 ~ 3133652 (-)
G202944 NA other upstream 3484371 3985342 ~ 3986402 (-)

Expression


Co-expression Network