G200682


Basic Information

Item Value
gene id G200682
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 1367124 ~ 1367339 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU227718
GTCGGTCTTAGTACACGATGTAACTACAGAAGAGTCAAGTTTTAATTAGGAAAAATATCGAAAATCTCTTTGGTCATTTTTGAGTGAGATGCTAACGGTCTAATCAGATTCAATGAACTATGCTAAGCTATGCTAAATGTGGTACCGCCAGACCTGGAGATCGGCTGAATGGATTTGAAAACGGTAAAACTCAACTGTTTAACTCTAGGGGAGTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU227718 True 216 lncRNA 0.39 1 1367124 1367339

Neighbor

gene id symbol gene type direction distance location
CI01000047_01337067_01353593 NA coding downstream 13531 1336969 ~ 1353593 (-)
CI01000047_01175229_01292056 ARID5B coding downstream 75068 1174588 ~ 1292056 (-)
CI01000047_01119401_01120162 ADOA coding downstream 246891 1119152 ~ 1120233 (-)
CI01000047_01071329_01073839 NRBF2B, NRBF2 coding downstream 293285 1070302 ~ 1073839 (-)
CI01000047_00892063_00896561 NA coding downstream 470563 890633 ~ 896561 (-)
CI01000047_01373782_01374697 NA coding upstream 6443 1373782 ~ 1374854 (-)
CI01000047_01375108_01392690 RHOBTB1.S, RHOBTB2, RHOBTB1 coding upstream 7574 1374913 ~ 1392690 (-)
CI01000047_01404421_01451987 NA coding upstream 37032 1404371 ~ 1452053 (-)
CI01000047_01470439_01470729 NA coding upstream 103060 1470399 ~ 1470794 (-)
CI01000047_01654684_01688086 PHYHIPL, PHYHIPLB coding upstream 286799 1654138 ~ 1688308 (-)
G200681 NA non-coding downstream 37 1366740 ~ 1367087 (-)
G200678 NA non-coding downstream 7512 1359390 ~ 1359612 (-)
G200657 NA non-coding downstream 39509 1327394 ~ 1327615 (-)
G200652 NA non-coding downstream 43367 1323497 ~ 1323757 (-)
G200626 NA non-coding downstream 224567 1134145 ~ 1142557 (-)
G200763 NA non-coding upstream 88844 1456183 ~ 1456534 (-)
G200720 NA non-coding upstream 184665 1552004 ~ 1553333 (-)
G200712 NA non-coding upstream 238946 1606285 ~ 1606652 (-)
G200711 NA non-coding upstream 239502 1606841 ~ 1607453 (-)
G200827 NA non-coding upstream 259282 1626621 ~ 1626846 (-)
G200472 NA other downstream 532653 833941 ~ 834471 (-)
CI01000047_00519408_00522108 PYYB other downstream 844882 519108 ~ 522245 (-)
G200299 NA other downstream 1099089 267530 ~ 268035 (-)
CI01000047_01708628_01744282 BICC1B, BICC1 other upstream 338729 1706068 ~ 1744282 (-)
G202733 NA other upstream 1764974 3132313 ~ 3133652 (-)
G202944 NA other upstream 2430464 3985342 ~ 3986402 (-)
CI01000047_04213574_04213976 NA other upstream 2846070 4213409 ~ 4214085 (-)
CI01000047_04285605_04286644 COA3A other upstream 2911569 4285227 ~ 4286694 (-)

Expression


Co-expression Network