G202792


Basic Information

Item Value
gene id G202792
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 3097841 ~ 3100120 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU230131
CTCCACAGGAAACGGTGGTTCTCTTTCACCACATCTAGATCGGTCTTATCTTTAGACGTGGATCGTCTGAGGTGTTCAACGCTCCCTCCATAATACAGAATGTAGTCGCTGATAAACTTCTTGTGACGTTCAAAAGCGTTCATTGATATCAGGTGTTGCCGTCGGTTTCTGGCTTCCTCTCTGTCCCATTCATGGGCAGCAACATTTTTATGGGCCACCTTGGTATGTCGACCTTTCTGGAATGGCTTCTGTAACAGCTCATCTTCACCTGCCCTTTTCTCATCATATTTGGACTGCCCTCCACCACCATCATCATCACTAAAATCAGAGTCATACCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU230131 True 338 lncRNA 0.46 5 3097841 3100120

Neighbor

gene id symbol gene type direction distance location
CI01000047_03087382_03094014 LGI1B coding downstream 1824 3087080 ~ 3096017 (-)
CI01000047_03085017_03085558 NA coding downstream 12150 3084995 ~ 3085691 (-)
CI01000047_03080182_03082134 SLC35G1 coding downstream 15707 3080086 ~ 3082134 (-)
CI01000047_03002349_03064708 PLCE1 coding downstream 32154 3002349 ~ 3065687 (-)
CI01000047_02939538_02940848 DRD6B coding downstream 155423 2939493 ~ 2942418 (-)
CI01000047_03115498_03127047 PDE6C coding upstream 15067 3115187 ~ 3128105 (-)
CI01000047_03136341_03145907 CEP55L coding upstream 35792 3135912 ~ 3145907 (-)
CI01000047_03149971_03159412 PRRT2 coding upstream 49840 3149960 ~ 3159412 (-)
CI01000047_03163127_03175326 KIF22 coding upstream 62746 3162866 ~ 3175326 (-)
CI01000047_03177108_03216092 ARHGAP27 coding upstream 76963 3177083 ~ 3216132 (-)
G202755 NA non-coding downstream 9141 3077993 ~ 3088700 (-)
G202747 NA non-coding downstream 124880 2966977 ~ 2972961 (-)
G202740 NA non-coding downstream 131242 2965854 ~ 2966599 (-)
G202774 NA non-coding downstream 198024 2896064 ~ 2899817 (-)
G202767 NA non-coding downstream 209046 2888578 ~ 2888795 (-)
G202757 NA non-coding upstream 13162 3113282 ~ 3113978 (-)
G202733 NA non-coding upstream 32193 3132313 ~ 3133652 (-)
G202847 NA non-coding upstream 232046 3332166 ~ 3334561 (-)
G202844 NA non-coding upstream 232730 3332850 ~ 3432629 (-)
G202842 NA non-coding upstream 299729 3399849 ~ 3407492 (-)
CI01000047_01708628_01744282 BICC1B, BICC1 other downstream 1382324 1706068 ~ 1744282 (-)
G200472 NA other downstream 2263370 833941 ~ 834471 (-)
CI01000047_00519408_00522108 PYYB other downstream 2575599 519108 ~ 522245 (-)
G200299 NA other downstream 2829806 267530 ~ 268035 (-)
G202944 NA other upstream 697683 3985342 ~ 3986402 (-)
CI01000047_04213574_04213976 NA other upstream 1113289 4213409 ~ 4214085 (-)
CI01000047_04285605_04286644 COA3A other upstream 1178788 4285227 ~ 4286694 (-)
CI01000047_04575184_04576337 GNGT2B, GNGT2 other upstream 1474215 4574335 ~ 4576342 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_005136 fra10ac1 coding NC_007123.7 CM002896.2 5156332 ~ 5188413 (-)