G202847


Basic Information

Item Value
gene id G202847
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 3332166 ~ 3334561 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU230194
CTGGCAAACAACAGGAAAGCTTCTTTGAACTCTTCAAGTTTTTCAGCACTGACATTACCTACAGCGGCAGGATCATTTTTGAAAGCTGGATTTGAAGGAGAAGCTTGTGCTTTGGCTGGTTCTTGGTCTGCTGCCACTGTTGCTGGCCCAGGTGCAGGGCTGGCTTTTTCAGGAGCTTTTGTAGCTGACTCTGGTGTTGCAGTTGGGGCAGAAGCAACTGTTTCCAGTGCTGCTGATGATGGCTCTGCTGCTCCGGGTGCTGGTTCTTCCTTTGGAGCTGGGGTTGGCTTTCCTTCTTTTTTGGGCACTTGCTTTTGTGAAGCCATGGTGGTTTAATCACAGTAAGTGAATGGACAAAAACTAGCTTAATTCAAATGTTTGACTGCTGTTGAATGGGAGCCCTAAATGTTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU230194 True 411 lncRNA 0.47 3 3332166 3334561

Neighbor

gene id symbol gene type direction distance location
CI01000047_03321589_03328761 GHRHR2 coding downstream 3405 3319692 ~ 3328761 (-)
CI01000047_03271413_03302291 SCN4AA coding downstream 29795 3269915 ~ 3302371 (-)
CI01000047_03258353_03261127 NA coding downstream 70341 3258353 ~ 3261825 (-)
CI01000047_03223945_03241971 NA coding downstream 89450 3223623 ~ 3242716 (-)
CI01000047_03177108_03216092 ARHGAP27 coding downstream 116034 3177083 ~ 3216132 (-)
CI01000047_03412414_03435209 KANSL1A coding upstream 77837 3412398 ~ 3436183 (-)
CI01000047_03514753_03523245 NA coding upstream 179890 3514451 ~ 3523245 (-)
CI01000047_03689400_03699969 NA coding upstream 354839 3689400 ~ 3699969 (-)
CI01000047_03713156_03716003 NA coding upstream 378595 3713156 ~ 3716003 (-)
CI01000047_03741720_03750331 MAPK7 coding upstream 406509 3741070 ~ 3750375 (-)
G202733 NA non-coding downstream 198514 3132313 ~ 3133652 (-)
G202757 NA non-coding downstream 218188 3113282 ~ 3113978 (-)
G202792 NA non-coding downstream 232046 3097841 ~ 3100120 (-)
G202755 NA non-coding downstream 243466 3077993 ~ 3088700 (-)
G202747 NA non-coding downstream 359205 2966977 ~ 2972961 (-)
G202842 NA non-coding upstream 65288 3399849 ~ 3407492 (-)
G202869 NA non-coding upstream 106266 3440827 ~ 3445116 (-)
G202870 NA non-coding upstream 110654 3445215 ~ 3445658 (-)
G202877 NA non-coding upstream 119969 3454530 ~ 3458840 (-)
G202880 NA non-coding upstream 136926 3471487 ~ 3471707 (-)
CI01000047_01708628_01744282 BICC1B, BICC1 other downstream 1616649 1706068 ~ 1744282 (-)
G200472 NA other downstream 2497695 833941 ~ 834471 (-)
CI01000047_00519408_00522108 PYYB other downstream 2809924 519108 ~ 522245 (-)
G200299 NA other downstream 3064131 267530 ~ 268035 (-)
G202944 NA other upstream 463242 3985342 ~ 3986402 (-)
CI01000047_04213574_04213976 NA other upstream 878848 4213409 ~ 4214085 (-)
CI01000047_04285605_04286644 COA3A other upstream 944347 4285227 ~ 4286694 (-)
CI01000047_04575184_04576337 GNGT2B, GNGT2 other upstream 1239774 4574335 ~ 4576342 (-)
G203286 NA other upstream 1539818 4874379 ~ 4876734 (-)

Expression


Co-expression Network