G201475



Basic Information


Item Value
gene id G201475
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 3794286 ~ 3794790 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU228634
GCCGATACCAAAAGTAGGTCTGTATTGGAGTCACGGTTCAAATCCACCACACACACCTCAGCTCCAAAATATGAGCCAATCTGAGGCTTAGGAGGATCCAGCTGCTTTGGGTCCTCTCCACCAATTCTTGAAACAGTTACTTGTCCCTTATGCTCGTGTCTTGGTGCTCCCATTACTGCATACTTTGCTTCTGACATTGTTGCTATTGCCAAGGAATAACCTAAATAACTGTCATGCTCACTTCCAGCTTGAAAGTCTGAATCTGAATCATTATTTGGTTTGTACAGCTGATATCCAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU228634 True 298 lncRNA 0.44 3 3794286 3794790

Neighbor


gene id symbol gene type direction distance location
CI01000047_03778996_03783444 NA coding upstream 10842 3778996 ~ 3783444 (+)
CI01000047_03771908_03778580 NA coding upstream 15706 3771908 ~ 3778580 (+)
CI01000047_03760606_03768136 NA coding upstream 26150 3760606 ~ 3768136 (+)
CI01000047_03752293_03755079 VKORC1 coding upstream 39127 3750931 ~ 3755159 (+)
CI01000047_03730436_03739299 NA coding upstream 54713 3730243 ~ 3739573 (+)
CI01000047_03823906_03854710 NA coding downstream 27356 3822146 ~ 3854814 (+)
CI01000047_04012371_04020979 ALDOAA, ALDOA, ALD, ALDOAB coding downstream 217534 4012324 ~ 4021255 (+)
CI01000047_04040223_04054395 NA coding downstream 245330 4040120 ~ 4054395 (+)
CI01000047_04056077_04061495 NA coding downstream 261287 4056077 ~ 4061495 (+)
CI01000047_04065102_04071608 BRAFLDRAFT_264576, BRAFLDRAFT_218264, BRAFLDRAFT_218328, PPP4CB, PPP4C, PPP4CA coding downstream 270312 4065102 ~ 4072324 (+)
G201462 NA non-coding upstream 37611 3756466 ~ 3756675 (+)
G201461 NA non-coding upstream 52420 3741053 ~ 3741866 (+)
G201428 NA non-coding upstream 74512 3715514 ~ 3719774 (+)
G201386 NA non-coding upstream 97936 3693528 ~ 3696350 (+)
G201379 NA non-coding upstream 105768 3687525 ~ 3688518 (+)
G201444 NA non-coding downstream 90265 3885055 ~ 3915947 (+)
G201439 NA non-coding downstream 98013 3892803 ~ 3921072 (+)
G201508 NA non-coding downstream 112624 3907414 ~ 3931682 (+)
G201509 NA non-coding downstream 112818 3907608 ~ 3931898 (+)
G201520 NA non-coding downstream 201669 3996459 ~ 3997356 (+)
G201387 NA other upstream 92426 3696516 ~ 3701860 (+)
G201186 NA other upstream 706099 3018705 ~ 3088187 (+)
G200076 NA other upstream 1216289 2520596 ~ 2577997 (+)
G200003 NA other upstream 1475324 2316863 ~ 2318962 (+)
CI01000047_01749606_01752688 NA other upstream 2041449 1749606 ~ 1752688 (+)
G201599 NA other downstream 621023 4415813 ~ 4482457 (+)
G202382 NA other downstream 3020927 6815717 ~ 6816118 (+)

Expression



Co-expression Network