G203143


Basic Information

Item Value
gene id G203143
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 4219397 ~ 4219733 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU230556
GTTCACTTGCTGCCTAATATATCCCACCCACTAACAGGAGCCGTGATGAAGAGATAATCAGTGTTATTCACTTCACCTGTCAGTGCTCATAATGTTATGCCTGATCGGTGTATGTCATCTGGATTACATAATCAGATTCCAAAGATTAAATACTTGTAATGAGATTATAATACTTTTTAAAATACTCATAATCAGAATACAGTTACTTTTTTATTGATTACATGATTACTTAATATTCACAAAATGGCACTAAATTATTCAGAATTCATTGATTCTCCCTAATTCTTCTTTTTTATCTTTTACATTTTCTTTTCTCACAGGTTTTATAGAATTGCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU230556 True 337 lncRNA 0.31 1 4219397 4219733

Neighbor

gene id symbol gene type direction distance location
CI01000047_04213574_04213976 NA coding downstream 5421 4213409 ~ 4214085 (-)
CI01000047_04137872_04142531 CABP5B, CABP5, CABP5A coding downstream 76866 4137599 ~ 4142531 (-)
CI01000047_04128025_04134725 NIF3L1 coding downstream 84672 4127902 ~ 4134725 (-)
CI01000047_04105620_04111019 NA coding downstream 108213 4105423 ~ 4111184 (-)
CI01000047_04022011_04032483 NA coding downstream 186731 4020885 ~ 4032666 (-)
CI01000047_04285605_04286644 COA3A coding upstream 65494 4285227 ~ 4286694 (-)
CI01000047_04289186_04338565 NA coding upstream 69330 4289063 ~ 4339770 (-)
CI01000047_04345335_04375341 NA coding upstream 125394 4345127 ~ 4375434 (-)
CI01000047_04385029_04397861 NA coding upstream 164814 4384547 ~ 4397861 (-)
CI01000047_04398951_04431817 NA coding upstream 179218 4398951 ~ 4431817 (-)
G202991 NA non-coding downstream 42627 4130712 ~ 4176770 (-)
G202997 NA non-coding downstream 124505 4094355 ~ 4094892 (-)
G203085 NA non-coding downstream 125776 4093419 ~ 4093621 (-)
G203084 NA non-coding downstream 125986 4093178 ~ 4093411 (-)
G203082 NA non-coding downstream 127462 4091709 ~ 4091935 (-)
G203189 NA non-coding upstream 188740 4408473 ~ 4408827 (-)
G203191 NA non-coding upstream 200426 4420159 ~ 4425359 (-)
G203204 NA non-coding upstream 282472 4502205 ~ 4502522 (-)
G203217 NA non-coding upstream 316608 4536341 ~ 4536570 (-)
G203219 NA non-coding upstream 325836 4545569 ~ 4546216 (-)
G202944 NA other downstream 232995 3985342 ~ 3986402 (-)
G202733 NA other downstream 1085745 3132313 ~ 3133652 (-)
CI01000047_01708628_01744282 BICC1B, BICC1 other downstream 2503880 1706068 ~ 1744282 (-)
G200472 NA other downstream 3384926 833941 ~ 834471 (-)
CI01000047_04575184_04576337 GNGT2B, GNGT2 other upstream 354602 4574335 ~ 4576342 (-)
G203286 NA other upstream 654646 4874379 ~ 4876734 (-)
G203840 NA other upstream 1698775 5918508 ~ 5927344 (-)
G203881 NA other upstream 1823520 6043253 ~ 6043789 (-)

Expression


Co-expression Network