G201581


Basic Information

Item Value
gene id G201581
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 4302574 ~ 4305252 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU228754
CTTTTTTCTTTCATGTTATATTTCATGGCTATTTATCATATTCTTTGTATTAAACAGTGATGTTAACTTCCTTAGACCCACCATCAACACGAAATACCCATCGTCCCGTCACATTGACATTGCTGGAGTTGGACAGCTTATTTGCATCAGGCGCAGGGATTGAAAAATAATTTGTTGAGTCTATTGTGTCGTAGCCAGCCTGAGTAAACAAAAAGTAATCATCATCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU228754 True 227 lncRNA 0.37 2 4302574 4305252

Neighbor

gene id symbol gene type direction distance location
CI01000047_04222867_04253291 NA coding upstream 48863 4222682 ~ 4253711 (+)
CI01000047_04214987_04217836 VPS25 coding upstream 84097 4214987 ~ 4218477 (+)
CI01000047_04198702_04207295 FAM57B, FAM57BB coding upstream 95169 4198702 ~ 4207405 (+)
CI01000047_04183386_04192887 MAZ coding upstream 109548 4183386 ~ 4193026 (+)
CI01000047_04153298_04179343 TAOK2A, TAOK2, TAOK2B coding upstream 121708 4153298 ~ 4182449 (+)
CI01000047_04471595_04476690 SGCA coding downstream 165873 4471125 ~ 4477217 (+)
CI01000047_04582184_04586359 TMEM101 coding downstream 276752 4582004 ~ 4586796 (+)
CI01000047_04606043_04610846 G6PC3 coding downstream 300791 4606043 ~ 4611322 (+)
CI01000047_04663268_04663847 NA coding downstream 357063 4662315 ~ 4663996 (+)
CI01000047_04678392_04690824 NA coding downstream 372740 4677992 ~ 4691097 (+)
G201526 NA non-coding upstream 237752 4063009 ~ 4064822 (+)
G201520 NA non-coding upstream 305218 3996459 ~ 3997356 (+)
G201509 NA non-coding upstream 370676 3907608 ~ 3931898 (+)
G201508 NA non-coding upstream 370892 3907414 ~ 3931682 (+)
G201609 NA non-coding downstream 103266 4408518 ~ 4408772 (+)
G201613 NA non-coding downstream 114932 4420184 ~ 4425415 (+)
G201599 NA non-coding downstream 173099 4415813 ~ 4482457 (+)
G201639 NA non-coding downstream 235047 4540299 ~ 4540501 (+)
G201641 NA non-coding downstream 240641 4545893 ~ 4546137 (+)
G201387 NA other upstream 600714 3696516 ~ 3701860 (+)
G201186 NA other upstream 1214387 3018705 ~ 3088187 (+)
G200076 NA other upstream 1724577 2520596 ~ 2577997 (+)
G200003 NA other upstream 1983612 2316863 ~ 2318962 (+)
CI01000047_01749606_01752688 NA other upstream 2549737 1749606 ~ 1752688 (+)
G202382 NA other downstream 2510465 6815717 ~ 6816118 (+)

Expression


Co-expression Network