G201609


Basic Information

Item Value
gene id G201609
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 4408518 ~ 4408772 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU228795
CACAGACAGCTCCCTCAAGAGCTGCCTGGGCATGCTCAACTCCCATTCAACTGCTGTTTTTCGCCATAATACGTGTCATTTTTATATATAAATATATGGATTGGTGTGAGATACTCTTGTCCTCAGATGAAGAGATTGTGACTTGTTTATGTAATAAGACAAACAACACCAAATAAGACACACGATAACACAGAGCGCTTGCTGAAGACAACAGAAGCTAGAGTTCTTTGTTCTGGGTATGCTTTATAGTTTCCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU228795 True 255 lncRNA 0.40 1 4408518 4408772

Neighbor

gene id symbol gene type direction distance location
CI01000047_04222867_04253291 NA coding upstream 154807 4222682 ~ 4253711 (+)
CI01000047_04214987_04217836 VPS25 coding upstream 190041 4214987 ~ 4218477 (+)
CI01000047_04198702_04207295 FAM57B, FAM57BB coding upstream 201113 4198702 ~ 4207405 (+)
CI01000047_04183386_04192887 MAZ coding upstream 215492 4183386 ~ 4193026 (+)
CI01000047_04153298_04179343 TAOK2A, TAOK2, TAOK2B coding upstream 227652 4153298 ~ 4182449 (+)
CI01000047_04471595_04476690 SGCA coding downstream 62353 4471125 ~ 4477217 (+)
CI01000047_04582184_04586359 TMEM101 coding downstream 173232 4582004 ~ 4586796 (+)
CI01000047_04606043_04610846 G6PC3 coding downstream 197271 4606043 ~ 4611322 (+)
CI01000047_04663268_04663847 NA coding downstream 253543 4662315 ~ 4663996 (+)
CI01000047_04678392_04690824 NA coding downstream 269220 4677992 ~ 4691097 (+)
G201555 NA non-coding upstream 58744 4286779 ~ 4349774 (+)
G201581 NA non-coding upstream 103266 4302574 ~ 4305252 (+)
G201526 NA non-coding upstream 343696 4063009 ~ 4064822 (+)
G201520 NA non-coding upstream 411162 3996459 ~ 3997356 (+)
G201613 NA non-coding downstream 11412 4420184 ~ 4425415 (+)
G201599 NA non-coding downstream 69579 4415813 ~ 4482457 (+)
G201639 NA non-coding downstream 131527 4540299 ~ 4540501 (+)
G201641 NA non-coding downstream 137121 4545893 ~ 4546137 (+)
G201642 NA non-coding downstream 138480 4547252 ~ 4547455 (+)
G201387 NA other upstream 706658 3696516 ~ 3701860 (+)
G201186 NA other upstream 1320331 3018705 ~ 3088187 (+)
G200076 NA other upstream 1830521 2520596 ~ 2577997 (+)
G200003 NA other upstream 2089556 2316863 ~ 2318962 (+)
CI01000047_01749606_01752688 NA other upstream 2655681 1749606 ~ 1752688 (+)
G202382 NA other downstream 2406945 6815717 ~ 6816118 (+)

Expression


Co-expression Network